Construct: ORF TRCN0000487932
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021511.1_s317c1
- DNA Barcode:
- TGGAGCCCGATACTTACTTGACAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- USP30 (84749)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487932
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84749 | USP30 | ubiquitin specific peptidas... | NM_032663.5 | 98.1% | 98.2% | 1_27del;639T>C |
| 2 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_005253962.3 | 98% | 98% | 1_27del;577_578insAGC;636T>C |
| 3 | human | 84749 | USP30 | ubiquitin specific peptidas... | NM_001301175.1 | 95.6% | 95.6% | 0_1ins66;546T>C |
| 4 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_006719653.3 | 95.6% | 95.6% | 0_1ins66;546T>C |
| 5 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_024449227.1 | 92.3% | 92.3% | 1_27del;639T>C;947_1045del |
| 6 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020048.1 | 91.6% | 91.6% | 1_27del;639T>C;1168_1278del |
| 7 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020049.1 | 91.4% | 91.5% | (many diffs) |
| 8 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020050.1 | 89.1% | 89.1% | 0_1ins66;546T>C;1075_1185del |
| 9 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020051.2 | 89.1% | 89.1% | 0_1ins66;546T>C;1075_1185del |
| 10 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020052.2 | 89.1% | 89.1% | 0_1ins66;546T>C;1075_1185del |
| 11 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_005253965.4 | 86.3% | 86.4% | 1_27del;189_190ins183;456T>C |
| 12 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_024449228.1 | 83.5% | 83.6% | 0_1ins66;96_97ins183;363T>C |
| 13 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020053.1 | 80.6% | 80.6% | (many diffs) |
| 14 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_011538894.2 | 72.3% | 72.4% | 0_1ins417;133_134insAGC;192T>C |
| 15 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020054.1 | 67.4% | 67.5% | (many diffs) |
| 16 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | NM_001033202.3 | 84.2% | 88.2% | (many diffs) |
| 17 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | XM_017320581.1 | 84% | 88% | (many diffs) |
| 18 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | XM_011248156.2 | 62.4% | 64.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1593
- ORF length:
- 1524
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gaccgcggcc gacagggcca tccagcgctt cctgcggacc ggggcggccg 121 tcagatataa agtcatgaag aactggggag ttataggtgg aattgctgct gctcttgcag 181 caggaatata tgttatttgg ggtcccatta cagaaagaaa gaagcgtaga aaagggcttg 241 tgcctggcct tgttaattta gggaacacct gcttcatgaa ctccctgcta caaggcctgt 301 ctgcctgtcc tgctttcatc aggtggctgg aagagttcac ctcccagtac tccagggatc 361 agaaggagcc cccctcacac cagtatttat ccttaacact cttgcacctt ctgaaagcct 421 tgtcctgcca agaagttact gatgatgagg tcttagatgc aagctgcttg ttggatgtct 481 taagaatgta cagatggcag atctcatcat ttgaagaaca ggatgctcac gaattattcc 541 atgtcattac ctcgtcattg gaagatgagc gagaccgcca gcctcgggtc acacatttgt 601 ttgatgtgca ttccctggag cagcagtcag aaataactcc caaacaaatt acctgccgca 661 caagagggtc acctcacccc acatccaatc actggaagtc tcaacatcct tttcatggaa 721 gactcactag taatatggtc tgcaaacact gtgaacacca gagtcctgtt cgatttgata 781 cctttgatag cctttcacta agtattccag ccgccacatg gggtcaccca ttgaccctgg 841 accactgcct tcaccacttc atctcatcag aatcagtgcg ggatgttgtg tgtgacaact 901 gtacaaagat tgaagccaag ggaacgttga acggggaaaa ggtggaacac cagaggacca 961 cttttgttaa acagttaaaa ctagggaagc tccctcagtg tctctgcatc cacctacagc 1021 ggctgagctg gtccagccac ggcacgcctc tgaagcggca tgagcacgtg cagttcaatg 1081 agttcctgat gatggacatt tacaagtacc acctccttgg acataaacct agtcaacaca 1141 accctaaact gaacaagaac ccagggccta cactggagct gcaggatggg ccgggagccc 1201 ccacaccagt tctgaatcag ccaggggccc ccaaaacaca gatttttatg aatggcgcct 1261 gctccccatc tttattgcca acgctgtcag cgccgatgcc cttccctctc ccagttgttc 1321 ccgactacag ctcctccaca taccTCTTCC GGCTGATGGC AGTTGTCGTC CACCATGGAG 1381 ACATGCACTC TGGACACTTT GTCACTTACC GACGGTCCCC ACCTTCTGCC AGGAACCCTC 1441 TCTCAACTAG CAATCAGTGG CTGTGGGTCT CCGATGACAC TGTCCGCAAG GCCAGCCTGC 1501 AGGAGGTCCT GTCCTCCAGC GCCTACCTGC TGTTCTACGA GCGCGTCCTT TCCAGGATGC 1561 AGCACCAGAG CCAGGAGTGC AAGTCTGAAG AATAGAACCC AGCTTTCTTG TACAAAGTGG 1621 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1681 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1741 ATGGAGCCCG ATACTTACTT GACACACGCG TTAAGTCgac aatcaacctc tggattacaa 1801 aatttgtgaa agatt