Construct: ORF TRCN0000488041
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020133.1_s317c1
- DNA Barcode:
- AATCCCTCTTGATCACATCACAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CKMT1B (1159)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488041
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001015001.2 | 100% | 100% | |
| 2 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321926.1 | 100% | 100% | |
| 3 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NM_020990.4 | 99.8% | 100% | 1056A>G;1086T>C |
| 4 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521197.2 | 99.8% | 100% | 1056A>G;1086T>C |
| 5 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321927.1 | 93% | 93% | 148_240del |
| 6 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321928.1 | 93% | 93% | 148_240del |
| 7 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022369.1 | 93% | 93% | 148_240del |
| 8 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022370.1 | 93% | 93% | 148_240del |
| 9 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521194.1 | 92.9% | 93% | 148_240del;1149A>G;1179T>C |
| 10 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521195.2 | 92.9% | 93% | 148_240del;1149A>G;1179T>C |
| 11 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521196.1 | 92.9% | 93% | 148_240del;1149A>G;1179T>C |
| 12 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521198.1 | 88.7% | 88.7% | (many diffs) |
| 13 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321929.1 | 61.8% | 60.9% | 0_1ins433;11_12ins44 |
| 14 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_005254498.4 | 61.8% | 60.9% | 0_1ins433;11_12ins44 |
| 15 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_005254150.4 | 61.7% | 60.9% | (many diffs) |
| 16 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521199.2 | 61.7% | 60.9% | (many diffs) |
| 17 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_017021902.1 | 61.7% | 60.9% | (many diffs) |
| 18 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NR_135856.1 | 59.5% | (many diffs) | |
| 19 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135751.1 | 46.2% | (many diffs) | |
| 20 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135750.1 | 44.4% | (many diffs) | |
| 21 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135748.1 | 43.7% | (many diffs) | |
| 22 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135749.1 | 41.8% | (many diffs) | |
| 23 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022371.1 | 41.2% | 34.5% | 148_240del;537_538ins44;648_649ins652 |
| 24 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | NM_001355069.1 | 92.2% | 96.6% | (many diffs) |
| 25 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | NM_009897.3 | 92.2% | 96.6% | (many diffs) |
| 26 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | XM_006498656.3 | 92.2% | 96.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1323
- ORF length:
- 1251
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctggt cccttctccc gtctgctgtc cgcccgcccg ggactcaggc 121 tcctggcttt ggccggagcg gggtctctag ccgctgggtt tctgctccga ccggaacctg 181 tacgagctgc cagtgaacga cggaggctgt atcccccgag cgctgagtac ccagacctcc 241 gaaagcacaa caactgcatg gccagtcacc tgaccccagc agtctatgca cggctctgcg 301 acaagaccac acccactggt tggacgctag atcagtgtat ccagactggc gtggacaacc 361 ctggccaccc cttcatcaag actgtgggca tggtggctgg agatgaggag acctatgagg 421 tatttgctga cctgtttgac cctgtgatcc aagagcgaca caatggatat gacccccgga 481 caatgaagca caccacggat ctagatgcca gtaaaatccg ttctggctac tttgatgaga 541 ggtatgtatt gtcctctaga gtcagaactg gccgaagcat ccgaggactc agtctgcctc 601 cagcttgcac tcgagcagag cgacgagagg tggaacgtgt tgtggtggat gcactgagtg 661 gcctgaaggg tgacctggct ggacgttact ataggctcag tgagatgaca gaggctgaac 721 agcagcagct tattgatgac cactttctgt ttgataagcc tgtgtccccg ttgctgactg 781 cagcaggaat ggctcgagac tggccagatg ctcgtggaat ttggcacaac aatgagaaga 841 gcttcctgat ctgggtgaat gaggaggatc atacacgggt gatctccatg gagaagggtg 901 gtaacatgaa gagagtgttt gaaagattct gccgaggcct caaagaggtg gagagactta 961 tccaagaacg tggctgggag ttcatgtgga atgagcgttT GGGATACATC TTGACCTGTC 1021 CATCTAACCT GGGCACTGGA CTTCGGGCAG GAGTGCACAT CAAACTGCCC CTGCTAAGCA 1081 AAGATAGCCG CTTCCCAAAG ATCCTGGAGA ACCTAAGACT CCAAAAGCGT GGTACTGGAG 1141 GAGTGGACAC TGCTGCCACA GGCGGTGTCT TTGATATTTC TAATTTGGAC CGACTAGGCA 1201 AATCAGAGGT GGAGCTGGTG CAACTGGTCA TCGATGGAGT AAACTATTTG ATTGATTGTG 1261 AACGGCGTCT GGAGAGAGGC CAGGATATCC GCATCCCCAC ACCTGTCATC CACACCAAGC 1321 ATTGAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1381 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1441 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAATCCCTCT TGATCACATC ACAACACGCG 1501 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt