Construct: ORF TRCN0000488049
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021191.1_s317c1
- DNA Barcode:
- TAGGCGGCAACGACACCTTGACTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- WLS (79971)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488049
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79971 | WLS | Wnt ligand secretion mediator | NM_024911.7 | 99.9% | 100% | 432G>A |
| 2 | human | 79971 | WLS | Wnt ligand secretion mediator | XM_011542191.2 | 93.6% | 91.7% | (many diffs) |
| 3 | human | 79971 | WLS | Wnt ligand secretion mediator | NM_001002292.3 | 93.2% | 91.4% | (many diffs) |
| 4 | human | 79971 | WLS | Wnt ligand secretion mediator | XM_017002390.2 | 91.6% | 91.6% | 0_1ins135;297G>A |
| 5 | human | 79971 | WLS | Wnt ligand secretion mediator | XM_011542192.3 | 85.5% | 83.7% | (many diffs) |
| 6 | human | 79971 | WLS | Wnt ligand secretion mediator | NM_001193334.1 | 83.1% | 82.9% | 106_107ins273;159G>A |
| 7 | mouse | 68151 | Wls | wntless homolog (Drosophila) | NM_026582.4 | 89.5% | 96.1% | (many diffs) |
| 8 | mouse | 68151 | Wls | wntless homolog (Drosophila) | XM_006501964.2 | 89.5% | 96.1% | (many diffs) |
| 9 | mouse | 68151 | Wls | wntless homolog (Drosophila) | NR_037590.1 | 52.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1695
- ORF length:
- 1623
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctggg gcaattatag aaaacatgag caccaagaag ctgtgcattg 121 ttggtgggat tctgctcgtg ttccaaatca tcgcctttct ggtgggaggc ttgattgctc 181 cagggcccac aacggcagtg tcctacatgt cggtgaaatg tgtggatgcc cgtaagaacc 241 atcacaagac aaaatggttc gtgccttggg gacccaatca ttgtgacaag atccgagaca 301 ttgaagaggc aattccaagg gaaattgaag ccaatgacat cgtgttttct gttcacattc 361 ccctccccca catggagatg agtccttggt tccaattcat gctgtttatc ctgcagctgg 421 acattgcctt caagctaaac aaccaaatca gagaaaatgc agaagtctcc atggacgttt 481 ccctggctta ccgtgatgac gcatttgctg agtggactga aatggcccat gaaagagtac 541 cacggaaact caaatgcacc ttcacatctc ccaagactcc agagcatgag ggccgttact 601 atgaatgtga tgtccttcct ttcatggaaa ttgggtctgt ggcccataag ttttaccttt 661 taaacatccg gctgcctgtg aatgagaaga agaaaatcaa tgtgggaatt ggggagataa 721 aggatatccg gttggtgggg atccaccaaa atggaggctt caccaaggtg tggtttgcca 781 tgaagacctt ccttacgccc agcatcttca tcattatggt gtggtattgg aggaggatca 841 ccatgatgtc ccgaccccca gtgcttctgg aaaaagtcat ctttgccctt gggatttcca 901 tgacctttat caatatccca gtggaatggt tttccatcgg gtttgactgg acctggatgc 961 tgctgtttgg tgacatccga cagggcatct tctatgcgat gcttctgtcc ttctggatca 1021 tcttctgtgg cgagcacatg atggatcagc acgagcggaa ccacatcgca gggtattgga 1081 agcaagtcgg acccattgcc gttggctcct tctgcctctt catatttgac atgtgtgaga 1141 gaggggtaca actcacgaat cccttctaca gtatctggac tacagacatt ggaacagagc 1201 tggccatggc cttcatcatc gtggctggaa tctgcctctg cctctacttc ctgtttctat 1261 gcttcatggt atttcaggtg tttcggaaca tcagtgggaa gcagtccagc ctgccagcta 1321 tgagcaaagt ccggcggcta cactatgagg ggctaatttt taggttcaag ttcctcatgc 1381 ttatcacctt ggccTGCGCT GCCATGACTG TCATCTTCTT CATCGTTAGT CAGGTAACGG 1441 AAGGCCATTG GAAATGGGGC GGCGTCACAG TCCAAGTGAA CAGTGCCTTT TTCACAGGCA 1501 TCTATGGGAT GTGGAATCTG TATGTCTTTG CTCTGATGTT CTTGTATGCA CCATCCCATA 1561 AAAACTATGG AGAAGACCAG TCCAATGGCG ATCTGGGTGT CCATAGTGGG GAAGAACTCC 1621 AGCTCACCAC CACTATCACC CATGTGGACG GACCCACTGA GATCTACAAG TTGACCCGCA 1681 AGGAGGCCCA GGAGTAGGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1741 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1801 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATAGGCGG CAACGACACC 1861 TTGACTCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt