Transcript: Human NM_024911.7

Homo sapiens Wnt ligand secretion mediator (WLS), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
WLS (79971)
Length:
2716
CDS:
225..1850

Additional Resources:

NCBI RefSeq record:
NM_024911.7
NBCI Gene record:
WLS (79971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024911.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138525 CCATGAAAGAGTACCACGGAA pLKO.1 680 CDS 100% 2.640 3.696 N WLS n/a
2 TRCN0000138094 GTATTGGAGGAGGATCACCAT pLKO.1 977 CDS 100% 2.640 3.696 N WLS n/a
3 TRCN0000137627 GTTTCGGAACATCAGTGGGAA pLKO.1 1433 CDS 100% 2.640 2.112 N WLS n/a
4 TRCN0000138901 GATCTACAAGTTGACCCGCAA pLKO.1 1814 CDS 100% 2.160 1.728 N WLS n/a
5 TRCN0000133999 CTGCCTCTTCATATTTGACAT pLKO.1 1265 CDS 100% 4.950 3.465 N WLS n/a
6 TRCN0000138414 CTTCATCATCGTGGCTGGAAT pLKO.1 1364 CDS 100% 4.950 3.465 N WLS n/a
7 TRCN0000135510 GCCTGTGAATGAGAAGAAGAA pLKO.1 827 CDS 100% 4.950 3.465 N WLS n/a
8 TRCN0000138115 GTCATCTTTGCCCTTGGGATT pLKO.1 1029 CDS 100% 4.050 2.835 N WLS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024911.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491389 CACACCTTTGTATTCTATGAAAAG pLX_317 12.2% 99.8% 99.8% V5 432G>A;1623_1624insG n/a
2 TRCN0000488049 TAGGCGGCAACGACACCTTGACTC pLX_317 19% 99.9% 100% V5 (not translated due to prior stop codon) 432G>A n/a
3 ccsbBroadEn_12651 pDONR223 100% 81.4% 81.5% None 1_300del;432G>A n/a
4 ccsbBroad304_12651 pLX_304 0% 81.4% 81.5% V5 1_300del;432G>A n/a
5 TRCN0000467337 CACGTATATACCTACTTTCAATTG pLX_317 30.3% 81.4% 81.5% V5 1_300del;432G>A n/a
Download CSV