Construct: ORF TRCN0000488181
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019876.1_s317c1
- DNA Barcode:
- GGGGGCGCCCTGAACCATACCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AK5 (26289)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488181
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001010.2 | 38.4% | 38.4% | 1_945del;1536_1537insG |
| 2 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001011.2 | 38.4% | 38.4% | 1_945del;1536_1537insG |
| 3 | human | 26289 | AK5 | adenylate kinase 5 | NM_012093.4 | 36.7% | 36.6% | 1_1017del;1608_1609insG |
| 4 | human | 26289 | AK5 | adenylate kinase 5 | XM_006710572.3 | 36.7% | 36.6% | 1_1017del;1608_1609insG |
| 5 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001008.2 | 36.7% | 36.6% | 1_1017del;1608_1609insG |
| 6 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001009.1 | 36.7% | 36.6% | 1_1017del;1608_1609insG |
| 7 | human | 26289 | AK5 | adenylate kinase 5 | XM_005270739.5 | 36.5% | 36.5% | 1_1023del;1614_1615insG |
| 8 | human | 26289 | AK5 | adenylate kinase 5 | NM_174858.3 | 35% | 34.9% | 1_1095del;1686_1687insG |
| 9 | mouse | 229949 | Ak5 | adenylate kinase 5 | NM_001081277.1 | 30.3% | 30.3% | (many diffs) |
| 10 | mouse | 229949 | Ak5 | adenylate kinase 5 | XM_011240115.2 | 29.2% | 27.3% | (many diffs) |
| 11 | mouse | 229949 | Ak5 | adenylate kinase 5 | XM_006501440.3 | 27% | 26.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 663
- ORF length:
- 594
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gggaggtttc atggaagatt tgagaaagtg taaaattatt ttcataattg 121 gtggtcctgg ctctggcaaa ggcacacagt gtgaaaagct ggtggaaaaa tatggattta 181 cacatctctc aactggcgag ctcctgcgtg aggaactggc atcagaatct gaaagaagca 241 aattgatcag agacattatg gaacgtggag acctggtgcc ctcaggcatc gttttggagc 301 tcctgaagga ggccatggtg gccagcctcg gggacaccag gggcttccTG ATTGACGGCT 361 ATCCTCGGGA GGTGAAGCAA GGGGAAGAGT TCGGACGCAG GATTGGAGAC CCACAGTTGG 421 TGATCTGTAT GGACTGCTCG GCAGACACCA TGACCAACCG CCTTCTCCAA AGGAGCCGGA 481 GCAGCCTGCC TGTGGACGAC ACCACCAAGA CCATCGCCAA GCGCCTAGAA GCCTACTACC 541 GAGCGTCCAT CCCCGTGATC GCCTACTACG AGACAAAAAC ACAGCTACAC AAGATAAATG 601 CAGAGGGAAC ACCAGAGGAC GTTTTTCTTC AACTCTGCAC AGCTATTGAC TCTATTTTCG 661 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 721 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 781 TTTATATATC TTGTGGAAAG GACGAGGGGG CGCCCTGAAC CATACCTATA CGCGTTAAGT 841 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt