Transcript: Mouse XM_011240115.2

PREDICTED: Mus musculus adenylate kinase 5 (Ak5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ak5 (229949)
Length:
3349
CDS:
515..2215

Additional Resources:

NCBI RefSeq record:
XM_011240115.2
NBCI Gene record:
Ak5 (229949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322381 CAGGACGATGATCAGCTAAAT pLKO_005 1571 CDS 100% 13.200 18.480 N Ak5 n/a
2 TRCN0000322382 GGGACAGCATATCCCTATTTC pLKO_005 2511 3UTR 100% 13.200 18.480 N Ak5 n/a
3 TRCN0000025584 ACCATGACTAACCGCCTTCTT pLKO.1 1988 CDS 100% 4.950 3.465 N Ak5 n/a
4 TRCN0000025585 CAAACTGATCCGTGACATCAT pLKO.1 1780 CDS 100% 4.950 3.465 N Ak5 n/a
5 TRCN0000322379 CAAACTGATCCGTGACATCAT pLKO_005 1780 CDS 100% 4.950 3.465 N Ak5 n/a
6 TRCN0000025588 CCTCAGAGTCAGAAAGAAGCA pLKO.1 1761 CDS 100% 2.640 1.848 N Ak5 n/a
7 TRCN0000322378 CCTCAGAGTCAGAAAGAAGCA pLKO_005 1761 CDS 100% 2.640 1.848 N Ak5 n/a
8 TRCN0000025586 CGGTGCCAAGAGCATTGCCAA pLKO.1 2041 CDS 100% 0.880 0.616 N Ak5 n/a
9 TRCN0000322320 CGGTGCCAAGAGCATTGCCAA pLKO_005 2041 CDS 100% 0.880 0.616 N Ak5 n/a
10 TRCN0000025587 CCTGGGCAACACCAAGGGCTT pLKO.1 1867 CDS 100% 0.000 0.000 N Ak5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488605 TATCTCCTCTGCAGGTCTTGTGGC pLX_317 18.9% 84.4% 87.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491369 GCCTTTCTAGTGGCGGGGCCTAGA pLX_317 18.8% 84.4% 87.3% V5 (many diffs) n/a
3 TRCN0000489010 CATAGGTAGGCGTCCACATGACTA pLX_317 52.4% 29.3% 27.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491546 AGGCATTCTGCGACTCAAGTTTGA pLX_317 60.9% 29.3% 27.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488181 GGGGGCGCCCTGAACCATACCTAT pLX_317 52.4% 29.2% 27.3% V5 (many diffs) n/a
Download CSV