Transcript: Human XM_005270739.5

PREDICTED: Homo sapiens adenylate kinase 5 (AK5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AK5 (26289)
Length:
3166
CDS:
257..1873

Additional Resources:

NCBI RefSeq record:
XM_005270739.5
NBCI Gene record:
AK5 (26289)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270739.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196485 GTGCTATCAATCAGTTGTAAA pLKO.1 2942 3UTR 100% 13.200 18.480 N AK5 n/a
2 TRCN0000220633 CGATATGGATTCCAATACATT pLKO.1 647 CDS 100% 5.625 7.875 N AK5 n/a
3 TRCN0000335948 CGATATGGATTCCAATACATT pLKO_005 647 CDS 100% 5.625 7.875 N AK5 n/a
4 TRCN0000194731 CGGAGATCCTTTCTAAGAAAT pLKO.1 482 CDS 100% 13.200 10.560 N AK5 n/a
5 TRCN0000196669 GTGATGCATTTCAGCAATTAT pLKO.1 2622 3UTR 100% 15.000 10.500 N AK5 n/a
6 TRCN0000220635 CCTTGATCCTTCGATGATATT pLKO.1 1177 CDS 100% 13.200 9.240 N AK5 n/a
7 TRCN0000335949 CCTTGATCCTTCGATGATATT pLKO_005 1177 CDS 100% 13.200 9.240 N AK5 n/a
8 TRCN0000220632 GCACAGCTATTGACTCTATTT pLKO.1 1848 CDS 100% 13.200 9.240 N AK5 n/a
9 TRCN0000335950 GCACAGCTATTGACTCTATTT pLKO_005 1848 CDS 100% 13.200 9.240 N AK5 n/a
10 TRCN0000196484 GCATGAGATATTTGCTATTTC pLKO.1 2676 3UTR 100% 13.200 9.240 N AK5 n/a
11 TRCN0000381362 TCAGGGTGATGACCAGTTAAA pLKO_005 1240 CDS 100% 13.200 9.240 N AK5 n/a
12 TRCN0000196382 GCATTGTTATTGATGGATTTC pLKO.1 825 CDS 100% 10.800 7.560 N AK5 n/a
13 TRCN0000195147 CAAGGTGAAATGGGATACATT pLKO.1 412 CDS 100% 5.625 3.938 N AK5 n/a
14 TRCN0000220631 CCTCTCATTAAGCATCCCTAA pLKO.1 2237 3UTR 100% 4.050 2.835 N AK5 n/a
15 TRCN0000335867 GGCAGTTGACAACAAGTTATT pLKO_005 1123 CDS 100% 13.200 7.920 N AK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270739.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488605 TATCTCCTCTGCAGGTCTTGTGGC pLX_317 18.9% 95.7% 95.7% V5 (not translated due to prior stop codon) 246_247ins72 n/a
2 TRCN0000491369 GCCTTTCTAGTGGCGGGGCCTAGA pLX_317 18.8% 95.6% 95.5% V5 246_247ins72;1614_1615insG n/a
3 TRCN0000489010 CATAGGTAGGCGTCCACATGACTA pLX_317 52.4% 36.6% 36.6% V5 (not translated due to prior stop codon) 1_1023del n/a
4 TRCN0000491546 AGGCATTCTGCGACTCAAGTTTGA pLX_317 60.9% 36.6% 36.6% V5 (not translated due to prior stop codon) 1_1023del n/a
5 TRCN0000488181 GGGGGCGCCCTGAACCATACCTAT pLX_317 52.4% 36.5% 36.5% V5 1_1023del;1614_1615insG n/a
Download CSV