Construct: ORF TRCN0000488232
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020157.1_s317c1
- DNA Barcode:
- TGCTCTAAATTATAAATGATCATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PFKP (5214)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488232
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_002627.5 | 99.9% | 100% | 1281A>G |
| 2 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_005252466.4 | 96.8% | 96.5% | (many diffs) |
| 3 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323067.1 | 96.2% | 95.4% | (many diffs) |
| 4 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323071.2 | 95.1% | 95.1% | 0_1ins114;1167A>G |
| 5 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323072.1 | 95.1% | 95.1% | 0_1ins114;1167A>G |
| 6 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001345944.1 | 95.1% | 95.1% | 0_1ins114;1167A>G |
| 7 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_024448038.1 | 95.1% | 95.1% | 0_1ins114;1167A>G |
| 8 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_005252465.4 | 93.8% | 93.8% | 1281A>G;1684_1836del |
| 9 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323068.2 | 93.4% | 93.4% | 1281A>G;1530_1531ins153 |
| 10 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001242339.1 | 92.2% | 85.9% | (many diffs) |
| 11 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_006717449.1 | 89.3% | 89.3% | 0_1ins114;1167A>G;1570_1722del |
| 12 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323069.2 | 78.4% | 78.4% | 0_1ins507;774A>G |
| 13 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323073.1 | 72.4% | 72.4% | 0_1ins648;633A>G |
| 14 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323074.1 | 72.4% | 72.4% | 0_1ins648;633A>G |
| 15 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323070.1 | 65.9% | 65.9% | 0_1ins648;633A>G;882_883ins153 |
| 16 | mouse | 56421 | Pfkp | phosphofructokinase, platelet | NM_019703.4 | 82.1% | 88.2% | (many diffs) |
| 17 | mouse | 56421 | Pfkp | phosphofructokinase, platelet | NM_001291071.1 | 80.1% | 85.8% | (many diffs) |
| 18 | mouse | 56421 | Pfkp | phosphofructokinase, platelet | XM_006516487.3 | 76.2% | 82% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2424
- ORF length:
- 2352
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggacgcg gacgactccc gggcccccaa gggctccttg cggaagttcc 121 tggagcacct ctccggggcc ggcaaggcca tcggcgtgct gaccagcggc ggggatgctc 181 aaggtatgaa cgctgccgtc cgtgccgtgg tgcgcatggg tatctacgtg ggggccaagg 241 tgtacttcat ctacgagggc taccagggca tggtggacgg aggctcaaac atcgcagagg 301 ccgactggga gagtgtctcc agcatcctgc aagtgggcgg gacgatcatt ggcagtgcgc 361 ggtgccaggc cttccgcacg cgggaaggcc gcctgaaggc tgcttgcaac ctgctgcagc 421 gcggcatcac caacctgtgt gtgatcggcg gggacgggag cctcaccggg gccaacctct 481 tccggaagga gtggagtggg ctgctggagg agctggccag gaacggccag atcgataagg 541 aggccgtgca gaagtacgcc tacctcaacg tggtgggcat ggtgggctcc atcgacaatg 601 atttctgcgg caccgacatg accatcggca cggactccgc cctgcacagg atcatcgagg 661 tcgtcgacgc catcatgacc acggcccaga gccaccagag gaccttcgtt ctggaggtga 721 tgggacgaca ctgtgggtac ctggccctgg tgagtgcctt ggcctgcggt gcggactggg 781 tgttccttcc agaatctcca ccagaggaag gctgggagga gcagatgtgt gtcaaactct 841 cggagaaccg tgcccggaaa aaaaggctga atattattat tgtggctgaa ggagcaattg 901 atacccaaaa taaacccatc acctctgaga aaatcaaaga gcttgtcgtc acgcagctgg 961 gctatgacac acgtgtgacc atcctcgggc acgtgcagag aggagggacc ccttcggcat 1021 tcgacaggat cttggccagc cgcatgggag tggaggcagt catcgccttg ctagaggcca 1081 ccccggacac cccagcttgc gtcgtgtcac tgaacgggaa ccacgccgtg cgcctgccgc 1141 tgatggagtg cgtgcagatg actcaggatg tgcagaaggc gatggacgag aggagatttc 1201 aagatgcggt tcgactccga gggaggagct ttgcgggcaa cctgaacacc tacaagcgac 1261 ttgccatcaa gctgccggat gatcagatcc caaagaccaa ttgcaacgta gctgtcatca 1321 acgtgggggc acccgcggct gggatgaacg cggccgtacg ctcagctgtg cgcgtgggca 1381 ttgccgacgg ccacaggatg ctcgccatct atgatggctt tgacggcttc gccaagggcc 1441 agatcaaaga aatcggctgg acagatgtcg ggggctggac cggccaagga ggctccattc 1501 ttgggacaaa acgcgttctc ccggggaagt acttggaaga gatcgccaca cagatgcgca 1561 cgcacagcat caacgcgctg ctgatcatcg gtggattcga ggcctacctg ggactcctgg 1621 agctgtcagc cgcccgggag aagcacgagg agttctgtgt ccccatggtc atggttcccg 1681 ctactgtgtc caacaatgtg ccgggttccg atttcagcat cggggcagac accgccctga 1741 acactatcac cgacacctgc gaccgcatca agcagtccgc cagcggaacc aagcggcgcg 1801 tgttcatcat cgagaccatg ggcggctact gtggctacct ggccaacatg ggggggctcg 1861 cggccggagc tgatgccgca tacattttcg aagagccctt cgacatcagg gatctgcagt 1921 ccaacgtgga gcacctgacg gagaaaatga agaccaccat ccagagaggc cttgtgctca 1981 gaaatgagag ctgcagtgaa aactacacca ccgacttcat ttaccagctg tattcagaag 2041 agggcaaagg cgtgtttgac tgcaggaaga acgtgctggg tcacatgcag cagggtgggg 2101 caccctctcc atttgataga aactttGGAA CCAAAATCTC TGCCAGAGCT ATGGAGTGGA 2161 TCACTGCAAA ACTCAAGGAG GCCCGGGGCA GAGGAAAAAA ATTTACCACC GATGATTCCA 2221 TTTGTGTGCT GGGAATAAGC AAAAGAAACG TTATTTTTCA ACCTGTGGCA GAGCTGAAGA 2281 AGCAAACGGA TTTTGAGCAC AGGATTCCCA AAGAACAGTG GTGGCTCAAG CTACGGCCCC 2341 TCATGAAAAT CCTGGCCAAG TACAAGGCCA GCTATGACGT GTCGGACTCA GGCCAGCTGG 2401 AACATGTGCA GCCCTGGAGT GTCTGAGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 2461 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 2521 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGCTCTAA 2581 ATTATAAATG ATCATCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2641 aagatt