Construct: ORF TRCN0000488315
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021694.1_s317c1
- DNA Barcode:
- ATGGATCTGATGTTACCCCCACTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FLT3 (2322)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488315
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020489.1 | 59.9% | 59.9% | 1_834del |
| 2 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020488.1 | 59.4% | 59.4% | 1_852del |
| 3 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535017.2 | 50.8% | 50.8% | 1_1206del |
| 4 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535018.2 | 50.8% | 50.8% | 1_1206del |
| 5 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020487.1 | 50.8% | 50.8% | 1_1206del |
| 6 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020486.1 | 45.1% | 45.1% | 1_1515del |
| 7 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535015.2 | 42.7% | 42.7% | 1_1674del |
| 8 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NM_004119.3 | 41.8% | 41.8% | 1_1731del |
| 9 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NM_004119.2:c.2508_2510del | 41.7% | 41.7% | 1_1731del;2505_2506insATC |
| 10 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NR_130706.2 | 31.5% | 1_1797del;2274_2405del;3178_3958del | |
| 11 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | XM_006504805.3 | 61.2% | 64.9% | (many diffs) |
| 12 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | XM_006504804.3 | 56.1% | 59.4% | (many diffs) |
| 13 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | NM_010229.2 | 35% | 37% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1320
- ORF length:
- 1248
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttaca gatggtacag gtgaccggct cctcagataa tgagtacttc tacgttgatt 121 tcagagaata tgaatatgat ctcaaatggg agtttccaag agaaaattta gagtttggga 181 aggtactagg atcaggtgct tttggaaaag tgatgaacgc aacagcttat ggaattagca 241 aaacaggagt ctcaatccag gttgccgtca aaatgctgaa agaaaaagca gacagctctg 301 aaagagaggc actcatgtca gaactcaaga tgatgaccca gctgggaagc cacgagaata 361 ttgtgaacct gctgggggcg tgcacactgt caggaccaat ttacttgatt tttgaatact 421 gttgctatgg tgatcttctc aactatctaa gaagtaaaag agaaaaattt cacaggactt 481 ggacagagat tttcaaggaa cacaatttca gtttttaccc cactttccaa tcacatccaa 541 attccagcat gcctggttca agagaagttc agatacaccc ggactcggat caaatctcag 601 ggcttcatgg gaattcattt cactctgaag atgaaattga atatgaaaac caaaaaaggc 661 tggaagaaga ggaggacttg aatgtgctta catttgaaga tcttctttgc tttgcatatc 721 aagttgccaa aggaatggaa tttctggaat ttaagtcgtg tgttcacaga gacctggccg 781 ccaggaacgt gcttgtcacc cacgggaaag tggtgaagat atgtgacttt ggattggctc 841 gagatatcat gagtgattcc aactatgttg tcaggggcaa tgcccgtctg cctgtaaaat 901 ggatggcccc cgaaagcctg tttgaaggca tctacaccat taagagtgat gtctggtcat 961 atggaatatt actgtgggaa atcttctcac ttggtgtgaa tccttaccct ggcattccgg 1021 ttgatgctaa cttctacaaa ctgattcaaa atggatttaa aatggatcag ccattttatg 1081 ctacagaaga aatatacatt ataatgcaat ccTGCTGGGC TTTTGACTCA AGGAAACGGC 1141 CATCCTTCCC TAATTTGACT TCGTTTTTAG GATGTCAGCT GGCAGATGCA GAAGAAGCGA 1201 TGTATCAGAA TGTGGATGGC CGTGTTTCGG AATGTCCTCA CACCTACCAA AACAGGCGAC 1261 CTTTCAGCAG AGAGATGGAT TTGGGGCTAC TCTCTCCGCA GGCTCAGGTC GAAGATTCGT 1321 AGGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1381 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1441 GGCTTTATAT ATCTTGTGGA AAGGACGAAT GGATCTGATG TTACCCCCAC TTACGCGTTA 1501 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt