Construct: ORF TRCN0000488330
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020350.1_s317c1
- DNA Barcode:
- CTGTTAGTTGTCGCTACCAGCCTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- VRK1 (7443)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488330
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7443 | VRK1 | VRK serine/threonine kinase 1 | NM_003384.3 | 100% | 100% | |
| 2 | human | 7443 | VRK1 | VRK serine/threonine kinase 1 | XM_017021624.2 | 99.7% | 99.7% | 1065_1066insAAG |
| 3 | human | 7443 | VRK1 | VRK serine/threonine kinase 1 | XM_017021625.1 | 99.4% | 99.4% | 1_6delATGAAA |
| 4 | human | 7443 | VRK1 | VRK serine/threonine kinase 1 | XM_006720247.4 | 94.2% | 94.2% | 1160_1231del |
| 5 | human | 7443 | VRK1 | VRK serine/threonine kinase 1 | XM_011537132.1 | 94% | 94% | 1065_1066insAAG;1157_1228del |
| 6 | human | 7443 | VRK1 | VRK serine/threonine kinase 1 | XR_001750539.2 | 64.1% | 1_68del;776_777ins121;1136_1543del | |
| 7 | human | 7443 | VRK1 | VRK serine/threonine kinase 1 | XM_017021626.2 | 61.6% | 59.8% | 708_709ins121;732_733ins335 |
| 8 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | NM_001029844.1 | 84.4% | 87.1% | (many diffs) |
| 9 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_017315046.1 | 84.4% | 87.1% | (many diffs) |
| 10 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | NM_001029843.1 | 80.8% | 82.9% | (many diffs) |
| 11 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_011244103.1 | 79.9% | 82.1% | (many diffs) |
| 12 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | NM_011705.3 | 76.4% | 78.4% | (many diffs) |
| 13 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_006515809.2 | 76.4% | 78.4% | (many diffs) |
| 14 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_006515810.3 | 76.4% | 78.4% | (many diffs) |
| 15 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_006515811.3 | 76.4% | 78.4% | (many diffs) |
| 16 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_006515812.2 | 76.4% | 78.4% | (many diffs) |
| 17 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_017315045.1 | 76.2% | 78.1% | (many diffs) |
| 18 | mouse | 22367 | Vrk1 | vaccinia related kinase 1 | XM_011244104.2 | 51.7% | 52.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1260
- ORF length:
- 1188
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcctcgt gtaaaagcag ctcaagctgg aagacagagc tctgcaaaga 121 gacatcttgc agaacaattt gcagttggag agataataac tgacatggca aaaaaggaat 181 ggaaagtagg attacccatt ggccaaggag gctttggctg tatatatctt gctgatatga 241 attcttcaga gtcagttggc agtgatgcac cttgtgttgt aaaagtggaa cccagtgaca 301 atggacctct ttttactgaa ttaaagttct accaacgagc tgcaaaacca gagcaaattc 361 agaaatggat tcgtacccgt aagctgaagt acctgggtgt tcctaagtat tgggggtctg 421 gtctacatga caaaaatgga aaaagttaca ggtttatgat aatggatcgc tttgggagtg 481 accttcagaa aatatatgaa gcaaatgcca aaaggttttc tcggaaaact gtcttgcagc 541 taagcttaag aattctggat attctggaat atattcacga gcatgagtat gtgcatggag 601 atatcaaggc ctcaaatctt cttctgaact acaagaatcc tgaccaggtg tacttggtag 661 attatggcct tgcttatcgg tactgcccag aaggagttca taaagaatac aaagaagacc 721 ccaaaagatg tcacgatggc actattgaat tcacgagcat cgatgcacac aatggcgtgg 781 ccccatcaag acgtggtgat ttggaaatac ttggttattg catgatccaa tggcttactg 841 gccatcttcc ttgggaggat aatttgaaag atcctaaata tgttagagat tccaaaatta 901 gatacagaga aaatattgca agtttgatgg acaaatgttt tcctgagaaa aacaaaCCAG 961 GTGAAATTGC CAAATACATG GAAACAGTGA AATTACTAGA CTACACTGAA AAACCTCTTT 1021 ATGAAAATTT ACGTGACATT CTTTTGCAAG GACTAAAAGC TATAGGAAGT AAGGATGATG 1081 GCAAATTGGA CCTCAGTGTT GTGGAGAATG GAGGTTTGAA AGCAAAAACA ATAACAAAGA 1141 AGCGAAAGAA AGAAATTGAA GAAAGCAAGG AACCTGGTGT TGAAGATACG GAATGGTCAA 1201 ACACACAGAC AGAGGAGGCC ATACAGACCC GTTCAAGAAC CAGAAAGAGA GTCCAGAAGT 1261 GAGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1321 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1381 GGCTTTATAT ATCTTGTGGA AAGGACGACT GTTAGTTGTC GCTACCAGCC TCACGCGTTA 1441 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt