Transcript: Mouse XM_017315046.1

PREDICTED: Mus musculus vaccinia related kinase 1 (Vrk1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vrk1 (22367)
Length:
1787
CDS:
238..1428

Additional Resources:

NCBI RefSeq record:
XM_017315046.1
NBCI Gene record:
Vrk1 (22367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322117 ATGGATTCGTACACATAAATT pLKO_005 531 CDS 100% 15.000 21.000 N Vrk1 n/a
2 TRCN0000023780 CCCATCAAGACGTGGTGATTT pLKO.1 948 CDS 100% 13.200 18.480 N Vrk1 n/a
3 TRCN0000361502 CTGAATCTTTAGTCGTCATAA pLKO_005 1613 3UTR 100% 13.200 18.480 N Vrk1 n/a
4 TRCN0000361570 ACCTTGGTGTTCCTAAGTATT pLKO_005 557 CDS 100% 13.200 10.560 N Vrk1 n/a
5 TRCN0000322052 ACTTTACTGAAGGGTAATTTA pLKO_005 1585 3UTR 100% 15.000 10.500 N Vrk1 n/a
6 TRCN0000322114 AGAACCCTGACCAGGTATATT pLKO_005 800 CDS 100% 15.000 10.500 N Vrk1 n/a
7 TRCN0000361515 GGGATCTGGTCTACATGATAA pLKO_005 579 CDS 100% 13.200 9.240 N Vrk1 n/a
8 TRCN0000322053 CTGTATTGCAGCTAAGCTTAA pLKO_005 695 CDS 100% 10.800 7.560 N Vrk1 n/a
9 TRCN0000322115 GCCCAGAAGTAAACGAGATTC pLKO_005 1417 CDS 100% 10.800 7.560 N Vrk1 n/a
10 TRCN0000023783 CCTTGGGAAGATAACTTGAAA pLKO.1 1015 CDS 100% 5.625 3.938 N Vrk1 n/a
11 TRCN0000023779 CCAGTGACAATGGACCTCTTT pLKO.1 458 CDS 100% 4.950 3.465 N Vrk1 n/a
12 TRCN0000023781 CCCTGTGTTGTGAAAGTGGAA pLKO.1 436 CDS 100% 2.640 1.848 N Vrk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488330 CTGTTAGTTGTCGCTACCAGCCTC pLX_317 26% 84.4% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14876 pDONR223 100% 84.4% 47.9% None (many diffs) n/a
3 ccsbBroad304_14876 pLX_304 0% 84.4% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000469342 AACACCAGCCCCCAACCGAACCCG pLX_317 33.4% 84.4% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_07131 pDONR223 100% 84.3% 87.1% None (many diffs) n/a
6 ccsbBroad304_07131 pLX_304 0% 84.3% 87.1% V5 (many diffs) n/a
Download CSV