Transcript: Mouse NM_001029844.1

Mus musculus vaccinia related kinase 1 (Vrk1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Vrk1 (22367)
Length:
3664
CDS:
102..1292

Additional Resources:

NCBI RefSeq record:
NM_001029844.1
NBCI Gene record:
Vrk1 (22367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149172 CTGGGCAGTACCGATAAGCA pXPR_003 AGG 602 51% 8 0.6714 Vrk1 VRK1 75525
2 BRDN0001147568 TTTGTAGCCCCATCAAGACG pXPR_003 TGG 719 60% 9 0.1976 Vrk1 VRK1 75522
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322117 ATGGATTCGTACACATAAATT pLKO_005 395 CDS 100% 15.000 21.000 N Vrk1 n/a
2 TRCN0000023780 CCCATCAAGACGTGGTGATTT pLKO.1 812 CDS 100% 13.200 18.480 N Vrk1 n/a
3 TRCN0000361502 CTGAATCTTTAGTCGTCATAA pLKO_005 1477 3UTR 100% 13.200 18.480 N Vrk1 n/a
4 TRCN0000361570 ACCTTGGTGTTCCTAAGTATT pLKO_005 421 CDS 100% 13.200 10.560 N Vrk1 n/a
5 TRCN0000322052 ACTTTACTGAAGGGTAATTTA pLKO_005 1449 3UTR 100% 15.000 10.500 N Vrk1 n/a
6 TRCN0000322114 AGAACCCTGACCAGGTATATT pLKO_005 664 CDS 100% 15.000 10.500 N Vrk1 n/a
7 TRCN0000361515 GGGATCTGGTCTACATGATAA pLKO_005 443 CDS 100% 13.200 9.240 N Vrk1 n/a
8 TRCN0000322053 CTGTATTGCAGCTAAGCTTAA pLKO_005 559 CDS 100% 10.800 7.560 N Vrk1 n/a
9 TRCN0000322115 GCCCAGAAGTAAACGAGATTC pLKO_005 1281 CDS 100% 10.800 7.560 N Vrk1 n/a
10 TRCN0000023783 CCTTGGGAAGATAACTTGAAA pLKO.1 879 CDS 100% 5.625 3.938 N Vrk1 n/a
11 TRCN0000023779 CCAGTGACAATGGACCTCTTT pLKO.1 322 CDS 100% 4.950 3.465 N Vrk1 n/a
12 TRCN0000023781 CCCTGTGTTGTGAAAGTGGAA pLKO.1 300 CDS 100% 2.640 1.848 N Vrk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488330 CTGTTAGTTGTCGCTACCAGCCTC pLX_317 26% 84.4% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14876 pDONR223 100% 84.4% 47.9% None (many diffs) n/a
3 ccsbBroad304_14876 pLX_304 0% 84.4% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000469342 AACACCAGCCCCCAACCGAACCCG pLX_317 33.4% 84.4% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_07131 pDONR223 100% 84.3% 87.1% None (many diffs) n/a
6 ccsbBroad304_07131 pLX_304 0% 84.3% 87.1% V5 (many diffs) n/a
Download CSV