Transcript: Human XM_017021624.2

PREDICTED: Homo sapiens VRK serine/threonine kinase 1 (VRK1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VRK1 (7443)
Length:
1662
CDS:
69..1256

Additional Resources:

NCBI RefSeq record:
XM_017021624.2
NBCI Gene record:
VRK1 (7443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023780 CCCATCAAGACGTGGTGATTT pLKO.1 779 CDS 100% 13.200 18.480 N Vrk1 n/a
2 TRCN0000350396 GCGAGGTGGAAGTAATGATTA pLKO_005 1350 3UTR 100% 13.200 18.480 N VRK1 n/a
3 TRCN0000199332 CGAGCATCGATGCACACAATG pLKO.1 751 CDS 100% 10.800 15.120 N VRK1 n/a
4 TRCN0000314879 CGAGCATCGATGCACACAATG pLKO_005 751 CDS 100% 10.800 15.120 N VRK1 n/a
5 TRCN0000197134 GAGATATCAAGGCCTCAAATC pLKO.1 595 CDS 100% 10.800 15.120 N VRK1 n/a
6 TRCN0000350470 GAGATATCAAGGCCTCAAATC pLKO_005 595 CDS 100% 10.800 15.120 N VRK1 n/a
7 TRCN0000002132 GTTATCCCAAAGCCGTGTGTT pLKO.1 1478 3UTR 100% 4.950 6.930 N VRK1 n/a
8 TRCN0000199841 CTGTGAGTCTTGCGAGGTGGA pLKO.1 1339 3UTR 100% 0.720 1.008 N VRK1 n/a
9 TRCN0000023779 CCAGTGACAATGGACCTCTTT pLKO.1 289 CDS 100% 4.950 3.960 N Vrk1 n/a
10 TRCN0000196791 GAGGTGGAAGTAATGATTAAA pLKO.1 1352 3UTR 100% 15.000 10.500 N VRK1 n/a
11 TRCN0000002133 GAAGTAAGGATGATGGCAAAT pLKO.1 1063 CDS 100% 10.800 7.560 N VRK1 n/a
12 TRCN0000314952 GAAGTAAGGATGATGGCAAAT pLKO_005 1063 CDS 100% 10.800 7.560 N VRK1 n/a
13 TRCN0000002131 GTAGATTATGGCCTTGCTTAT pLKO.1 654 CDS 100% 10.800 7.560 N VRK1 n/a
14 TRCN0000314950 GTAGATTATGGCCTTGCTTAT pLKO_005 654 CDS 100% 10.800 7.560 N VRK1 n/a
15 TRCN0000194675 CCTAAATATGTTAGAGATTCC pLKO.1 870 CDS 100% 4.050 2.835 N VRK1 n/a
16 TRCN0000002130 AGATAATAACTGACATGGCAA pLKO.1 148 CDS 100% 2.640 1.848 N VRK1 n/a
17 TRCN0000195406 CAGAACAATTTGCAGTTGGAG pLKO.1 127 CDS 100% 2.640 1.848 N VRK1 n/a
18 TRCN0000002129 CCTGGTGTTGAAGATACGGAA pLKO.1 1167 CDS 100% 2.640 1.848 N VRK1 n/a
19 TRCN0000195048 CAGGTGAAATTGCCAAATACA pLKO.1 955 CDS 100% 5.625 3.375 N VRK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488330 CTGTTAGTTGTCGCTACCAGCCTC pLX_317 26% 99.7% 99.7% V5 (not translated due to prior stop codon) 1065_1066insAAG n/a
2 ccsbBroadEn_14876 pDONR223 100% 99.6% 52.4% None 619_620insA;1065_1066insAAG n/a
3 ccsbBroad304_14876 pLX_304 0% 99.6% 52.4% V5 (not translated due to prior stop codon) 619_620insA;1065_1066insAAG n/a
4 TRCN0000469342 AACACCAGCCCCCAACCGAACCCG pLX_317 33.4% 99.6% 52.4% V5 (not translated due to prior stop codon) 619_620insA;1065_1066insAAG n/a
5 ccsbBroadEn_07131 pDONR223 100% 99.5% 99.7% None 516G>A;705C>T;1065_1066insAAG n/a
6 ccsbBroad304_07131 pLX_304 0% 99.5% 99.7% V5 516G>A;705C>T;1065_1066insAAG n/a
Download CSV