Construct: ORF TRCN0000488350
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020964.1_s317c1
- DNA Barcode:
- GTTGACCGCAAGGATCTTGTAGTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PAQR5 (54852)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488350
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54852 | PAQR5 | progestin and adipoQ recept... | NM_001104554.1 | 99.8% | 99.6% | 71T>C |
2 | human | 54852 | PAQR5 | progestin and adipoQ recept... | NM_017705.4 | 99.8% | 99.6% | 71T>C |
3 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521720.2 | 99.8% | 99.6% | 71T>C |
4 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022360.1 | 99.8% | 99.6% | 71T>C |
5 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022361.1 | 99.8% | 99.6% | 71T>C |
6 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022362.1 | 99.8% | 99.6% | 71T>C |
7 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022363.1 | 99.8% | 99.6% | 71T>C |
8 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022364.1 | 99.8% | 99.6% | 71T>C |
9 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_024449966.1 | 99.8% | 99.6% | 71T>C |
10 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_005254495.4 | 95.4% | 94.8% | (many diffs) |
11 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521723.2 | 86.6% | 86.6% | 0_1ins132 |
12 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_024449967.1 | 68.5% | 50.2% | (many diffs) |
13 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521725.2 | 66.2% | 66% | 71T>C;178_179ins333 |
14 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022366.1 | 65.1% | 60.8% | 0_1ins139;39_40ins206 |
15 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521727.2 | 64.4% | 60.5% | 71T>C;608_609ins142;639_640ins209 |
16 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022368.1 | 53% | 53% | 0_1ins132;46_47ins333 |
17 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | NM_028748.2 | 88.2% | 91.2% | (many diffs) |
18 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511508.3 | 84.4% | 86.9% | (many diffs) |
19 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511509.2 | 70.6% | 72.4% | (many diffs) |
20 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511510.2 | 57.2% | 55.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1062
- ORF length:
- 990
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctgagc ctgaagctcc ccaggctgtt tagcatagac cagatacccc 121 aggtgttcca tgagcaaggc accctgttcg gctaccgcca tccacagagt tctgccactg 181 cctgcatcct cagccttttc caaatgacca atgagactct caacatttgg actcacttgc 241 tgcccttctg gttctttgca tggaggtttg tgactgcact gtatatgaca gacatcaaga 301 atgacagcta ctcctggccc atgcttgtgt acatgtgcac cagctgcgtg tacccacttg 361 tgtccagctg tgcgcacacc ttcagctcta tgtccaagaa tgcccggcac atttgctact 421 tcctggacta tggtgccgtc aacctcttca gcctgggctc agccattgcc tactctgcat 481 acacgttccc ggatgcgctc atgtgcacca ctttccatga ctactacgtg gccctggctg 541 tactgaacac catcctcagc acaggcctct cctgctactc caggtttctt gaaatccaga 601 agcccagact ctgtaaggtg attcgtgtcc tcgcctttgc ttatccgtac acctgggact 661 ccctccccat cttctacagg ctattcctgt tcccagggga gagtgcacaa aatgaagcca 721 cctcgtacca ccagaagcac atgatcatga cCCTCCTGGC CTCTTTCTTG TACTCTGCAC 781 ATCTGCCAGA ACGCCTAGCC CCTGGACGCT TTGACTACAT CGGTCACAGT CACCAGCTGT 841 TTCACGTGTG TGTGATCCTG GCCACGCACA TGCAGATGGA AGCCATACTT CTGGACAAGA 901 CTCTGAGGAA GGAATGGCTC CTGGCCACCT CCAAGCCCTT CTCTTTCTCT CAGATAGCTG 961 GAGCCATACT TCTGTGCATC ATCTTCAGCC TCAGCAACAT AATTTATTTC TCAGCTGCTC 1021 TGTATCGGAT TCCCAAGCCA GAATTACATA AAAAAGAAAC ATAGGACCCA GCTTTCTTGT 1081 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1141 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1201 GAAAGGACGA GTTGACCGCA AGGATCTTGT AGTTACGCGT TAAGTCgaca atcaacctct 1261 ggattacaaa atttgtgaaa gatt