Transcript: Human NM_001104554.1

Homo sapiens progestin and adipoQ receptor family member 5 (PAQR5), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
PAQR5 (54852)
Length:
5480
CDS:
669..1661

Additional Resources:

NCBI RefSeq record:
NM_001104554.1
NBCI Gene record:
PAQR5 (54852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001104554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062918 GCCAGTTTGATCTGCAAAGTA pLKO.1 2378 3UTR 100% 5.625 4.500 N PAQR5 n/a
2 TRCN0000062921 CCAATGAGACTCTCAACATTT pLKO.1 805 CDS 100% 13.200 9.240 N PAQR5 n/a
3 TRCN0000333858 CCAATGAGACTCTCAACATTT pLKO_005 805 CDS 100% 13.200 9.240 N PAQR5 n/a
4 TRCN0000062920 CGGATTCCCAAGCCAGAATTA pLKO.1 1623 CDS 100% 13.200 9.240 N PAQR5 n/a
5 TRCN0000333780 CGGATTCCCAAGCCAGAATTA pLKO_005 1623 CDS 100% 13.200 9.240 N PAQR5 n/a
6 TRCN0000062922 CTTCAGCTCTATGTCCAAGAA pLKO.1 977 CDS 100% 4.950 3.465 N PAQR5 n/a
7 TRCN0000333778 CTTCAGCTCTATGTCCAAGAA pLKO_005 977 CDS 100% 4.950 3.465 N PAQR5 n/a
8 TRCN0000062919 GCCCTTCTCTTTCTCTCAGAT pLKO.1 1532 CDS 100% 4.950 2.970 N PAQR5 n/a
9 TRCN0000333779 GCCCTTCTCTTTCTCTCAGAT pLKO_005 1532 CDS 100% 4.950 2.970 N PAQR5 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4446 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5225 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5225 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001104554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08419 pDONR223 100% 99.8% 99.6% None 71T>C n/a
2 ccsbBroad304_08419 pLX_304 0% 99.8% 99.6% V5 71T>C n/a
3 TRCN0000472590 TTAAAAGTCACTAAATATTTTCCG pLX_317 37% 99.8% 99.6% V5 71T>C n/a
4 TRCN0000488350 GTTGACCGCAAGGATCTTGTAGTT pLX_317 31.7% 99.8% 99.6% V5 (not translated due to prior stop codon) 71T>C n/a
5 TRCN0000489412 GAGAACGCACGCGAGCTGTACATA pLX_317 39% 99.7% 99.3% V5 71T>C;990_991insG n/a
Download CSV