Transcript: Mouse NM_028748.2

Mus musculus progestin and adipoQ receptor family member V (Paqr5), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Paqr5 (74090)
Length:
3500
CDS:
200..1192

Additional Resources:

NCBI RefSeq record:
NM_028748.2
NBCI Gene record:
Paqr5 (74090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173469 GAGGTTCATGACTGCACTCTA pLKO.1 391 CDS 100% 4.950 6.930 N Paqr5 n/a
2 TRCN0000175955 GCAAGCATCAAGGTGAGTTTA pLKO.1 3075 3UTR 100% 13.200 10.560 N Paqr5 n/a
3 TRCN0000174514 CAGCCTCAGCAACATTATTTA pLKO.1 1114 CDS 100% 15.000 10.500 N Paqr5 n/a
4 TRCN0000175559 CACATTCAGCTCTATGTCCAA pLKO.1 505 CDS 100% 2.640 1.848 N Paqr5 n/a
5 TRCN0000174630 GAGTTCAAGAAATGAAGCCAT pLKO.1 829 CDS 100% 2.640 1.848 N Paqr5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08419 pDONR223 100% 88.2% 91.2% None (many diffs) n/a
2 ccsbBroad304_08419 pLX_304 0% 88.2% 91.2% V5 (many diffs) n/a
3 TRCN0000472590 TTAAAAGTCACTAAATATTTTCCG pLX_317 37% 88.2% 91.2% V5 (many diffs) n/a
4 TRCN0000488350 GTTGACCGCAAGGATCTTGTAGTT pLX_317 31.7% 88.2% 91.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489412 GAGAACGCACGCGAGCTGTACATA pLX_317 39% 88.1% 90.9% V5 (many diffs) n/a
Download CSV