Transcript: Human XM_011521727.2

PREDICTED: Homo sapiens progestin and adipoQ receptor family member 5 (PAQR5), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAQR5 (54852)
Length:
1168
CDS:
434..1075

Additional Resources:

NCBI RefSeq record:
XM_011521727.2
NBCI Gene record:
PAQR5 (54852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062921 CCAATGAGACTCTCAACATTT pLKO.1 570 CDS 100% 13.200 9.240 N PAQR5 n/a
2 TRCN0000333858 CCAATGAGACTCTCAACATTT pLKO_005 570 CDS 100% 13.200 9.240 N PAQR5 n/a
3 TRCN0000062922 CTTCAGCTCTATGTCCAAGAA pLKO.1 742 CDS 100% 4.950 3.465 N PAQR5 n/a
4 TRCN0000333778 CTTCAGCTCTATGTCCAAGAA pLKO_005 742 CDS 100% 4.950 3.465 N PAQR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08419 pDONR223 100% 64.4% 60.5% None 71T>C;608_609ins142;639_640ins209 n/a
2 ccsbBroad304_08419 pLX_304 0% 64.4% 60.5% V5 71T>C;608_609ins142;639_640ins209 n/a
3 TRCN0000472590 TTAAAAGTCACTAAATATTTTCCG pLX_317 37% 64.4% 60.5% V5 71T>C;608_609ins142;639_640ins209 n/a
4 TRCN0000488350 GTTGACCGCAAGGATCTTGTAGTT pLX_317 31.7% 64.4% 60.5% V5 (not translated due to prior stop codon) 71T>C;608_609ins142;639_640ins209 n/a
5 TRCN0000489412 GAGAACGCACGCGAGCTGTACATA pLX_317 39% 64.3% 60.4% V5 71T>C;608_609ins142;639_640ins210 n/a
Download CSV