Construct: ORF TRCN0000488406
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020631.1_s317c1
- DNA Barcode:
- CACGTTACAAGTGGAGTCAGTTCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ZAP70 (7535)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488406
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7535 | ZAP70 | zeta chain of T cell recept... | NM_207519.1 | 100% | 100% | |
| 2 | human | 7535 | ZAP70 | zeta chain of T cell recept... | NM_001079.3 | 50.4% | 50.4% | 1_921del |
| 3 | human | 7535 | ZAP70 | zeta chain of T cell recept... | XM_017004868.1 | 42.3% | 42.3% | 1_1272del |
| 4 | human | 7535 | ZAP70 | zeta chain of T cell recept... | XM_017004867.1 | 42% | 42% | 1_1290del |
| 5 | human | 7535 | ZAP70 | zeta chain of T cell recept... | XM_017004869.1 | 38.3% | 37.3% | (many diffs) |
| 6 | human | 7535 | ZAP70 | zeta chain of T cell recept... | XM_017004870.1 | 37.2% | 36.5% | (many diffs) |
| 7 | human | 7535 | ZAP70 | zeta chain of T cell recept... | XR_001738927.1 | 24.5% | 1_2529del;3345_3553del;3639_3640ins35 | |
| 8 | human | 7535 | ZAP70 | zeta chain of T cell recept... | XR_001738926.1 | 20.7% | (many diffs) | |
| 9 | human | 7535 | ZAP70 | zeta chain of T cell recept... | XR_001738925.1 | 18.5% | (many diffs) | |
| 10 | mouse | 22637 | Zap70 | zeta-chain (TCR) associated... | NM_001289612.1 | 87.3% | 93.2% | (many diffs) |
| 11 | mouse | 22637 | Zap70 | zeta-chain (TCR) associated... | NM_001289765.1 | 44.1% | 47% | (many diffs) |
| 12 | mouse | 22637 | Zap70 | zeta-chain (TCR) associated... | NM_009539.3 | 44.1% | 47% | (many diffs) |
| 13 | mouse | 22637 | Zap70 | zeta-chain (TCR) associated... | XM_006495896.2 | 44.1% | 47% | (many diffs) |
| 14 | mouse | 22637 | Zap70 | zeta-chain (TCR) associated... | NM_001289766.1 | 42.5% | 45.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1008
- ORF length:
- 936
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcccatg gacacgagcg tgtatgagag cccctacagc gacccagagg 121 agctcaagga caagaagctc ttcctgaagc gcgataacct cctcatagct gacattgaac 181 ttggctgcgg caactttggc tcagtgcgcc agggcgtgta ccgcatgcgc aagaagcaga 241 tcgacgtggc catcaaggtg ctgaagcagg gcacggagaa ggcagacacg gaagagatga 301 tgcgcgaggc gcagatcatg caccagctgg acaaccccta catcgtgcgg ctcattggcg 361 tctgccaggc cgaggccctc atgctggtca tggagatggc tgggggcggg ccgctgcaca 421 agttcctggt cggcaagagg gaggagatcc ctgtgagcaa tgtggccgag ctgctgcacc 481 aggtgtccat ggggatgaag tacctggagg agaagaactt tgtgcaccgt gacctggcgg 541 cccgcaacgt cctgctggtt aaccggcact acgccaagat cagcgacttt ggcctctcca 601 aagcactggg tgccgacgac agctactaca ctgcccgctc agcagggaag tggccgctca 661 agtggtacgc acccgaatgc atcaacttcc gcaagttctc cagccgcagc gatgtctGGA 721 GCTATGGGGT CACCATGTGG GAGGCCTTGT CCTACGGCCA GAAGCCCTAC AAGAAGATGA 781 AAGGGCCGGA GGTCATGGCC TTCATCGAGC AGGGCAAGCG GATGGAGTGC CCACCAGAGT 841 GTCCACCCGA ACTGTACGCA CTCATGAGTG ACTGCTGGAT CTACAAGTGG GAGGATCGCC 901 CCGACTTCCT GACCGTGGAG CAGCGCATGC GAGCCTGTTA CTACAGCCTG GCCAGCAAGG 961 TGGAAGGGCC CCCAGGCAGC ACACAGAAGG CTGAGGCTGC CTGTGCCTAG AACCCAGCTT 1021 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1081 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1141 CTTGTGGAAA GGACGACACG TTACAAGTGG AGTCAGTTCA ACGCGTTAAG TCgacaatca 1201 acctctggat tacaaaattt gtgaaagatt