Transcript: Mouse NM_009539.3

Mus musculus zeta-chain (TCR) associated protein kinase (Zap70), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Zap70 (22637)
Length:
2247
CDS:
155..2011

Additional Resources:

NCBI RefSeq record:
NM_009539.3
NBCI Gene record:
Zap70 (22637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361517 ACAACGTATGCGGAACTATTA pLKO_005 1921 CDS 100% 13.200 18.480 N Zap70 n/a
2 TRCN0000023437 TGGACTAATTTACCGCTTGAA pLKO.1 886 CDS 100% 4.950 6.930 N Zap70 n/a
3 TRCN0000361499 GGTGCTGACGACAGCTATTAC pLKO_005 1610 CDS 100% 13.200 10.560 N Zap70 n/a
4 TRCN0000361504 TACTGGTCAATCGGCACTATG pLKO_005 1554 CDS 100% 10.800 8.640 N Zap70 n/a
5 TRCN0000361505 TGAAGGCGGATGGACTAATTT pLKO_005 876 CDS 100% 15.000 10.500 N Zap70 n/a
6 TRCN0000023435 CCCTGAGGAACTCAAAGACAA pLKO.1 1114 CDS 100% 4.950 3.465 N Zap70 n/a
7 TRCN0000023434 CGCAATGTTCTACTGGTCAAT pLKO.1 1544 CDS 100% 4.950 3.465 N Zap70 n/a
8 TRCN0000199795 GAGTGACTGCTGGATCTACAA pLKO.1 1867 CDS 100% 4.950 3.465 N ZAP70 n/a
9 TRCN0000023436 CCTCCTGAGATGTATGCACTT pLKO.1 1844 CDS 100% 4.050 2.835 N Zap70 n/a
10 TRCN0000199777 GCACCAAGTTTGACACGCTCT pLKO.1 831 CDS 100% 2.160 1.512 N ZAP70 n/a
11 TRCN0000023438 GTGCATCAACTTTCGGAAGTT pLKO.1 1678 CDS 100% 0.495 0.347 N Zap70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488407 TGCGAACGCTCCCGGTACCAGGAG pLX_317 13.4% 87.6% 93.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14879 pDONR223 0% 87.6% 93.5% None (many diffs) n/a
3 ccsbBroad304_14879 pLX_304 0% 87.6% 93.5% V5 (many diffs) n/a
4 TRCN0000479535 CAACCCAGCCTTGGCAATTCACAA pLX_317 14% 87.6% 93.5% V5 (many diffs) n/a
5 TRCN0000468243 CGCTTAACCAAAGGTGAGAAAGGC pLX_317 16.5% 87.6% 93.5% V5 (many diffs) n/a
6 ccsbBroadEn_15620 pDONR223 0% 69.3% 72.5% None (many diffs) n/a
7 ccsbBroad304_15620 pLX_304 0% 69.3% 72.5% V5 (many diffs) n/a
8 TRCN0000488406 CACGTTACAAGTGGAGTCAGTTCA pLX_317 31.5% 44.1% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV