Transcript: Human NM_207519.1

Homo sapiens zeta chain of T cell receptor associated protein kinase 70 (ZAP70), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ZAP70 (7535)
Length:
1468
CDS:
147..1085

Additional Resources:

NCBI RefSeq record:
NM_207519.1
NBCI Gene record:
ZAP70 (7535)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199839 CGCAACGTCCTGCTGGTTAAC pLKO.1 618 CDS 100% 3.600 5.040 N ZAP70 n/a
2 TRCN0000000436 CAGGCGTAGATCACCAGAATA pLKO.1 1409 3UTR 100% 13.200 9.240 N ZAP70 n/a
3 TRCN0000425608 GAACTTGGCTGCGGCAACTTT pLKO_005 252 CDS 100% 5.625 3.938 N ZAP70 n/a
4 TRCN0000199959 CGCACCCGAATGCATCAACTT pLKO.1 743 CDS 100% 4.950 3.465 N ZAP70 n/a
5 TRCN0000199795 GAGTGACTGCTGGATCTACAA pLKO.1 941 CDS 100% 4.950 3.465 N ZAP70 n/a
6 TRCN0000434100 TACGCCAAGATCAGCGACTTT pLKO_005 645 CDS 100% 4.950 3.465 N ZAP70 n/a
7 TRCN0000428505 TGCTTGGTTGTCTCCACACAC pLKO_005 1169 3UTR 100% 4.050 2.835 N ZAP70 n/a
8 TRCN0000000440 CGATAACCTCCTCATAGCTGA pLKO.1 227 CDS 100% 2.640 1.848 N ZAP70 n/a
9 TRCN0000000437 GAAGCCCTACAAGAAGATGAA pLKO.1 836 CDS 100% 4.950 2.970 N ZAP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488406 CACGTTACAAGTGGAGTCAGTTCA pLX_317 31.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_15620 pDONR223 0% 63.2% 63.2% None 0_1ins543 n/a
3 ccsbBroad304_15620 pLX_304 0% 63.2% 63.2% V5 0_1ins543 n/a
4 ccsbBroadEn_14879 pDONR223 0% 50.4% 50.4% None 0_1ins921 n/a
5 ccsbBroad304_14879 pLX_304 0% 50.4% 50.4% V5 0_1ins921 n/a
6 TRCN0000468243 CGCTTAACCAAAGGTGAGAAAGGC pLX_317 16.5% 50.4% 50.4% V5 0_1ins921 n/a
7 TRCN0000479535 CAACCCAGCCTTGGCAATTCACAA pLX_317 14% 50.4% 50.4% V5 0_1ins921 n/a
8 TRCN0000488407 TGCGAACGCTCCCGGTACCAGGAG pLX_317 13.4% 50.3% 50.4% V5 (not translated due to prior stop codon) 0_1ins921;756G>A n/a
Download CSV