Transcript: Mouse NM_001289612.1

Mus musculus zeta-chain (TCR) associated protein kinase (Zap70), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Zap70 (22637)
Length:
1343
CDS:
169..1107

Additional Resources:

NCBI RefSeq record:
NM_001289612.1
NBCI Gene record:
Zap70 (22637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289612.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361517 ACAACGTATGCGGAACTATTA pLKO_005 1017 CDS 100% 13.200 18.480 N Zap70 n/a
2 TRCN0000361499 GGTGCTGACGACAGCTATTAC pLKO_005 706 CDS 100% 13.200 10.560 N Zap70 n/a
3 TRCN0000361504 TACTGGTCAATCGGCACTATG pLKO_005 650 CDS 100% 10.800 8.640 N Zap70 n/a
4 TRCN0000023435 CCCTGAGGAACTCAAAGACAA pLKO.1 210 CDS 100% 4.950 3.465 N Zap70 n/a
5 TRCN0000023434 CGCAATGTTCTACTGGTCAAT pLKO.1 640 CDS 100% 4.950 3.465 N Zap70 n/a
6 TRCN0000199795 GAGTGACTGCTGGATCTACAA pLKO.1 963 CDS 100% 4.950 3.465 N ZAP70 n/a
7 TRCN0000023436 CCTCCTGAGATGTATGCACTT pLKO.1 940 CDS 100% 4.050 2.835 N Zap70 n/a
8 TRCN0000023438 GTGCATCAACTTTCGGAAGTT pLKO.1 774 CDS 100% 0.495 0.347 N Zap70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289612.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488406 CACGTTACAAGTGGAGTCAGTTCA pLX_317 31.5% 87.3% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15620 pDONR223 0% 55.3% 59% None (many diffs) n/a
3 ccsbBroad304_15620 pLX_304 0% 55.3% 59% V5 (many diffs) n/a
4 TRCN0000488407 TGCGAACGCTCCCGGTACCAGGAG pLX_317 13.4% 44.1% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14879 pDONR223 0% 44% 47% None (many diffs) n/a
6 ccsbBroad304_14879 pLX_304 0% 44% 47% V5 (many diffs) n/a
7 TRCN0000479535 CAACCCAGCCTTGGCAATTCACAA pLX_317 14% 44% 47% V5 (many diffs) n/a
8 TRCN0000468243 CGCTTAACCAAAGGTGAGAAAGGC pLX_317 16.5% 44% 47% V5 (many diffs) n/a
Download CSV