Construct: ORF TRCN0000488433
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021004.1_s317c1
- DNA Barcode:
- GCATCAACGCTTATCGTCCCCCTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- VIPR2 (7434)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488433
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_003382.5 | 99.9% | 100% | 393A>C |
| 2 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_005249561.3 | 92.9% | 91% | (many diffs) |
| 3 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_006716107.2 | 89.2% | 87% | (many diffs) |
| 4 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446914.1 | 85% | 74.6% | 0_1ins71;188_333del;468A>C |
| 5 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446915.1 | 85% | 74.6% | 0_1ins71;188_333del;468A>C |
| 6 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_001308259.1 | 83.3% | 76.5% | (many diffs) |
| 7 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_001304522.1 | 81.7% | 81.7% | 356_357ins240 |
| 8 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446917.1 | 81.4% | 80% | (many diffs) |
| 9 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446916.1 | 79.5% | 78.6% | (many diffs) |
| 10 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_011516550.2 | 74% | 65.1% | (many diffs) |
| 11 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_006716108.3 | 72% | 68.4% | (many diffs) |
| 12 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_017012580.1 | 68.4% | 68.4% | 0_1ins414 |
| 13 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446918.1 | 68.4% | 68.4% | 0_1ins414 |
| 14 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NR_130758.1 | 30.7% | 1_186del;1330_1663del;1835_4278del | |
| 15 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | NM_009511.2 | 81.6% | 85.2% | (many diffs) |
| 16 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_006515805.1 | 79.1% | 82% | (many diffs) |
| 17 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_011244102.1 | 75.1% | 72.9% | (many diffs) |
| 18 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_006515806.3 | 72.5% | 75.9% | (many diffs) |
| 19 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_017315044.1 | 49.9% | 52.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1386
- ORF length:
- 1314
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcggacg ctgctgcctc ccgcgctgct gacctgctgg ctgctcgccc 121 ccgtgaacag cattcaccca gaatgccgat ttcatctgga aatacaggag gaagaaacaa 181 aatgtgcaga gcttctgagg tctcaaacag aaaaacacaa agcctgcagt ggcgtctggg 241 acaacatcac gtgctggcgg cctgccaatg tgggagagac cgtcacggtg ccctgcccaa 301 aagtcttcag caatttttac agcaaagcag gaaacataag caaaaactgt acgagtgacg 361 gatggtcaga gacgttccca gatttcgtcg atgcctgtgg ctacagcgac ccggaggatg 421 agagcaagat cacgttttat attctggtga aggccattta taccctgggc tacagtgtct 481 ctctgatgtc tcttgcaaca ggaagcataa ttctgtgcct cttcaggaag ctgcactgca 541 ccaggaatta catccacctg aacctgttcc tgtccttcat cctgagagcc atctcagtgc 601 tggtcaagga cgacgttctc tactccagct ctggcacgtt gcactgccct gaccagccat 661 cctcctgggt gggctgcaag ctgagcctgg tcttcctgca gtactgcatc atggccaact 721 tcttctggct gctggtggag gggctctacc tccacaccct cctggtggcc atgctccccc 781 ctagaaggtg cttcctggcc tacctcctga tcggatgggg cctccccacc gtctgcatcg 841 gtgcatggac tgcggccagg ctctacttag aagacaccgg ttgctgggat acaaacgacc 901 acagtgtgcc ctggtgggtc atacgaatac cgattttaat ttccatcatc gtcaattttg 961 tccttttcat tagtattata cgaattttgc tgcagaagtt aacatcccca gatgtcGGCG 1021 GCAACGACCA GTCTCAGTAC AAGAGGCTGG CCAAGTCCAC GCTCCTGCTT ATCCCGCTGT 1081 TCGGCGTCCA CTACATGGTG TTTGCCGTGT TTCCCATCAG CATCTCCTCC AAATACCAGA 1141 TACTGTTTGA GCTGTGCCTC GGGTCGTTCC AGGGCCTGGT GGTGGCCGTC CTCTACTGTT 1201 TCCTGAACAG TGAGGTGCAG TGCGAGCTGA AGCGAAAATG GCGAAGCCGG TGCCCGACCC 1261 CGTCCGCGAG CCGGGATTAC AGGGTCTGCG GTTCCTCCTT CTCCCGCAAC GGCTCGGAGG 1321 GCGCCCTGCA GTTCCACCGC GGCTCCCGCG CCCAGTCCTT CCTGCAAACG GAGACCTCGG 1381 TCATCTAGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1441 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1501 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGCATCA ACGCTTATCG TCCCCCTGAC 1561 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt