Transcript: Human XM_024446914.1

PREDICTED: Homo sapiens vasoactive intestinal peptide receptor 2 (VIPR2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VIPR2 (7434)
Length:
4057
CDS:
225..1616

Additional Resources:

NCBI RefSeq record:
XM_024446914.1
NBCI Gene record:
VIPR2 (7434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014225 GTGGGTCATACGAATACCGAT pLKO.1 1142 CDS 100% 2.640 3.696 N VIPR2 n/a
2 TRCN0000358233 ACCGGTTGCTGGGATACAAAC pLKO_005 1104 CDS 100% 10.800 8.640 N VIPR2 n/a
3 TRCN0000014223 CGTGTTGTCATTGACTCGATT pLKO.1 1787 3UTR 100% 4.950 3.960 N VIPR2 n/a
4 TRCN0000014227 TGCCGATTTCATCTGGAAATA pLKO.1 226 CDS 100% 1.320 1.056 N VIPR2 n/a
5 TRCN0000358232 CTTGCAACAGGAAGCATAATT pLKO_005 720 CDS 100% 15.000 10.500 N VIPR2 n/a
6 TRCN0000358231 GTTGTCATTGACTCGATTTAA pLKO_005 1790 3UTR 100% 15.000 10.500 N VIPR2 n/a
7 TRCN0000014226 CAACGACCAGTCTCAGTACAA pLKO.1 1250 CDS 100% 4.950 3.465 N VIPR2 n/a
8 TRCN0000014224 GATGAGAGCAAGATCACGTTT pLKO.1 645 CDS 100% 4.950 3.465 N VIPR2 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2055 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01773 pDONR223 100% 85% 74.6% None 0_1ins71;188_333del;468A>C n/a
2 ccsbBroad304_01773 pLX_304 0% 85% 74.6% V5 0_1ins71;188_333del;468A>C n/a
3 TRCN0000468787 GTTCCTGTATACCGGATCGGATGC pLX_317 35.8% 85% 74.6% V5 0_1ins71;188_333del;468A>C n/a
4 TRCN0000488433 GCATCAACGCTTATCGTCCCCCTG pLX_317 28.5% 85% 74.6% V5 (not translated due to prior stop codon) 0_1ins71;188_333del;468A>C n/a
5 TRCN0000488785 AACGCGACCCGCAAATTTGATTCC pLX_317 28.4% 85% 74.4% V5 (many diffs) n/a
Download CSV