Construct: ORF TRCN0000488514
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019778.1_s317c1
- DNA Barcode:
- TCACTTTACTTCTAACTGCTTCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NEK6 (10783)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488514
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166168.1 | 99.7% | 99.6% | 697C>T;939_940insG |
| 2 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166170.1 | 99.7% | 99.6% | 697C>T;939_940insG |
| 3 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_014397.5 | 99.7% | 99.6% | 697C>T;939_940insG |
| 4 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_005251664.1 | 99.7% | 99.6% | 697C>T;939_940insG |
| 5 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_006716936.2 | 99.7% | 99.6% | 697C>T;939_940insG |
| 6 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447386.1 | 99.7% | 99.6% | 697C>T;939_940insG |
| 7 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447387.1 | 99.7% | 99.6% | 697C>T;939_940insG |
| 8 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166167.1 | 94.3% | 94.2% | 1_54del;751C>T;993_994insG |
| 9 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166169.1 | 92.4% | 92.3% | 1_75del;772C>T;1014_1015insG |
| 10 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001145001.2 | 90% | 89.9% | 1_102del;799C>T;1041_1042insG |
| 11 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166171.1 | 90% | 89.9% | 1_102del;799C>T;1041_1042insG |
| 12 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_017014217.1 | 90% | 89.9% | 1_102del;799C>T;1041_1042insG |
| 13 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447385.1 | 84.2% | 84.1% | 1_174del;871C>T;1113_1114insG |
| 14 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | NM_001159631.1 | 88.6% | 94.9% | (many diffs) |
| 15 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | NM_021606.3 | 88.6% | 94.9% | (many diffs) |
| 16 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | XM_006498210.3 | 88.6% | 94.9% | (many diffs) |
| 17 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | XM_006498209.3 | 77.5% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1014
- ORF length:
- 942
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcagga cagcccggcc acatgcccca tggagggagt tccaacaacc 121 tctgccacac cctggggcct gtgcatcctc ctgacccaca gaggcatccc aacacgctgt 181 cttttcgctg ctcgctggcg gacttccaga tcgaaaagaa gataggccga ggacagttca 241 gcgaggtgta caaggccacc tgcctgctgg acaggaagac agtggctctg aagaaggtgc 301 agatctttga gatgatggac gccaaggcga ggcaggactg tgtcaaggag atcggcctct 361 tgaagcaact gaaccaccca aatatcatca agtatttgga ctcgtttatc gaagacaacg 421 agctgaacat tgtgctggag ttggctgacg caggggacct ctcgcagatg atcaagtact 481 ttaagaagca gaagcggctc atcccggaga ggacagtatg gaagtacttt gtgcagctgt 541 gcagcgccgt ggagcacatg cattcacgcc gggtgatgca ccgagacatc aagcctgcca 601 acgtgttcat cacagccacg ggcgtcgtga agctcggtga ccttggtctg ggccgcttct 661 tcagctctga gaccaccgca gcccactccc TAGTGGGGAC GCCCTACTAC ATGTCACCGG 721 AGAGGATCCA TGAGAACGGC TACAACTTCA AGTCCGACAT CTGGTCCTTG GGCTGTCTGC 781 TGTACGAGAT GGCAGCCCTC CAGAGCCCCT TCTATGGAGA TAAGATGAAT CTCTTCTCCC 841 TGTGCCAGAA GATCGAGCAG TGTGACTACC CCCCACTCCC CGGGGAGCAC TACTCCGAGA 901 AGTTACGAGA ACTGGTCAGC ATGTGCATCT GCCCTGACCC CCACCAGAGA CCTGACATCG 961 GATACGTGCA CCAGGTGGCC AAGCAGATGC ACATCTGGAT GTCCAGCACC GACCCAGCTT 1021 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1081 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1141 CTTGTGGAAA GGACGATCAC TTTACTTCTA ACTGCTTCAT ACGCGTTAAG TCgacaatca 1201 acctctggat tacaaaattt gtgaaagatt