Construct: ORF TRCN0000488560
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021364.1_s317c1
- DNA Barcode:
- TTCACACAAAAGCCTCTCCCAGTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ACKR3 (57007)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488560
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | NM_020311.3 | 99.8% | 99.7% | 682A>G;796C>T |
| 2 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_005246097.3 | 99.8% | 99.7% | 682A>G;796C>T |
| 3 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_005246098.3 | 99.8% | 99.7% | 682A>G;796C>T |
| 4 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_017004516.2 | 99.8% | 99.7% | 682A>G;796C>T |
| 5 | mouse | 12778 | Ackr3 | atypical chemokine receptor 3 | NM_001271607.1 | 88.4% | 92.5% | (many diffs) |
| 6 | mouse | 12778 | Ackr3 | atypical chemokine receptor 3 | NM_007722.4 | 88.4% | 92.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1161
- ORF length:
- 1086
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggat ctgcatctct tcgactactc agagccaggg aacttctcgg 121 acatcagctg gccatgcaac agcagcgact gcatcgtggt ggacacggtg atgtgtccca 181 acatgcccaa caaaagcgtc ctgctctaca cgctctcctt catttacatt ttcatcttcg 241 tcatcggcat gattgccaac tccgtggtgg tctgggtgaa tatccaggcc aagaccacag 301 gctatgacac gcactgctac atcttgaacc tggccattgc cgacctgtgg gttgtcctca 361 ccatcccagt ctgggtggtc agtctcgtgc agcacaacca gtggcccatg ggcgagctca 421 cgtgcaaagt cacacacctc atcttctcca tcaacctctt cggcagcatt ttcttcctca 481 cgtgcatgag cgtggaccgc tacctctcca tcacctactt caccaacacc cccagcagca 541 ggaagaagat ggtacgccgt gtcgtctgca tcctggtgtg gctgctggcc ttctgcgtgt 601 ctctgcctga cacctactac ctgaagaccg tcacgtctgc gtccaacaat gagacctact 661 gccggtcctt ctaccccgag cacagcatca aggagtggct gatcggcatg gagctggtct 721 ccgttgtctt gggctttgcc gttcccttct ccattgtcgc tgtcttctac ttcctgctgg 781 ccagagccat ctcggcgtcc agtgaccagg agaagcacag cagccggaag atcatcttct 841 ccTACGTGGT GGTCTTCCTT GTCTGCTGGT TGCCCTACCA CGTGGCGGTG CTGCTGGACA 901 TCTTCTCCAT CCTGCACTAC ATCCCTTTCA CCTGCCGGCT GGAGCACGCC CTCTTCACGG 961 CCCTGCATGT CACACAGTGC CTGTCGCTGG TGCACTGCTG CGTCAACCCT GTCCTCTACA 1021 GCTTCATCAA TCGCAACTAC AGGTACGAGC TGATGAAGGC CTTCATCTTC AAGTACTCGG 1081 CCAAAACAGG GCTCACCAAG CTCATCGATG CCTCCAGAGT CTCAGAGACG GAGTACTCTG 1141 CCTTGGAGCA GAGCACCAAA TAGGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1201 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1261 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT TCACACAAAA 1321 GCCTCTCCCA GTGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1381 att