Transcript: Human XM_005246098.3

PREDICTED: Homo sapiens atypical chemokine receptor 3 (ACKR3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACKR3 (57007)
Length:
2245
CDS:
353..1441

Additional Resources:

NCBI RefSeq record:
XM_005246098.3
NBCI Gene record:
ACKR3 (57007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363205 CACTATTGGTGTACCTTATAA pLKO_005 1790 3UTR 100% 15.000 21.000 N ACKR3 n/a
2 TRCN0000358300 GGCATAGTGCTGACATATATT pLKO_005 1852 3UTR 100% 15.000 21.000 N ACKR3 n/a
3 TRCN0000363139 GCCGTTCCCTTCTCCATTATC pLKO_005 1016 CDS 100% 13.200 10.560 N ACKR3 n/a
4 TRCN0000014512 CGCTCTCCTTCATTTACATTT pLKO.1 489 CDS 100% 13.200 9.240 N ACKR3 n/a
5 TRCN0000378566 TCTTCGTCATCGGCATGATTG pLKO_005 513 CDS 100% 10.800 7.560 N ACKR3 n/a
6 TRCN0000014511 CTTCTCCATTATCGCTGTCTT pLKO.1 1024 CDS 100% 4.950 3.465 N ACKR3 n/a
7 TRCN0000014509 CCGGAAGATCATCTTCTCCTA pLKO.1 1102 CDS 100% 2.640 1.848 N ACKR3 n/a
8 TRCN0000014510 GCCAGGGAACTTCTCGGACAT pLKO.1 382 CDS 100% 1.350 0.945 N ACKR3 n/a
9 TRCN0000014508 CCCTGCATCCATTCTCTCTTT pLKO.1 1574 3UTR 100% 4.950 2.970 N ACKR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492025 ATGGTTTAAAAGGTCCACGTGAGA pLX_317 29.7% 99.9% 100% V5 (not translated due to prior stop codon) 162C>T n/a
2 TRCN0000488481 TATTCTCGTATAACACGAGCTGTG pLX_317 29.7% 99.9% 100% V5 (not translated due to prior stop codon) 162C>T n/a
3 TRCN0000489204 AGCGCCGTTGGGCGTACGATATCT pLX_317 29.5% 99.8% 99.7% V5 162C>T;1086_1087insG n/a
4 ccsbBroadEn_08684 pDONR223 100% 99.8% 99.7% None 682A>G;796C>T n/a
5 TRCN0000488560 TTCACACAAAAGCCTCTCCCAGTG pLX_317 29.6% 99.8% 99.7% V5 (not translated due to prior stop codon) 682A>G;796C>T n/a
6 TRCN0000488337 TCCACACTCTTTCTGTCCATTACA pLX_317 26.5% 99.7% 99.4% V5 682A>G;796C>T;1086_1087insG n/a
Download CSV