Construct: ORF TRCN0000488630
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021697.1_s317c1
- DNA Barcode:
- CAGTCTGCATCGTGCCGCATACGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MUSK (4593)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488630
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4593 | MUSK | muscle associated receptor ... | NM_001369398.1 | 70.6% | 70.6% | 1_396del |
2 | human | 4593 | MUSK | muscle associated receptor ... | XM_011518708.2 | 69.3% | 69.3% | 1_420del |
3 | human | 4593 | MUSK | muscle associated receptor ... | NM_001166281.2 | 41% | 41% | 1_1368del |
4 | human | 4593 | MUSK | muscle associated receptor ... | NM_001166280.2 | 40.4% | 40.4% | 1_1398del |
5 | human | 4593 | MUSK | muscle associated receptor ... | XM_017014734.1 | 40% | 40% | 1_1422del |
6 | human | 4593 | MUSK | muscle associated receptor ... | XM_005251996.3 | 36.8% | 36.8% | 1_1632del |
7 | human | 4593 | MUSK | muscle associated receptor ... | NM_005592.4 | 36.4% | 36.4% | 1_1656del |
8 | human | 4593 | MUSK | muscle associated receptor ... | XM_005251995.3 | 36.3% | 36.3% | 1_1662del |
9 | human | 4593 | MUSK | muscle associated receptor ... | XM_005251994.3 | 36% | 36% | 1_1686del |
10 | mouse | 18198 | Musk | muscle, skeletal, receptor ... | NM_001037130.1 | 32.5% | 35.6% | (many diffs) |
11 | mouse | 18198 | Musk | muscle, skeletal, receptor ... | NM_010944.2 | 32.2% | 35.3% | (many diffs) |
12 | mouse | 18198 | Musk | muscle, skeletal, receptor ... | NM_001037129.1 | 32.2% | 35.2% | (many diffs) |
13 | mouse | 18198 | Musk | muscle, skeletal, receptor ... | NM_001037128.1 | 31.9% | 34.9% | (many diffs) |
14 | mouse | 18198 | Musk | muscle, skeletal, receptor ... | XM_006537661.2 | 31.8% | 34.8% | (many diffs) |
15 | mouse | 18198 | Musk | muscle, skeletal, receptor ... | XM_006537659.2 | 31.5% | 34.5% | (many diffs) |
16 | mouse | 18198 | Musk | muscle, skeletal, receptor ... | NM_001037127.2 | 31.3% | 34.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 132
- ORF end:
- 1083
- ORF length:
- 951
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctcagc agcagtaacc ctcaccacac tgccttctga gctcttacta gatagacttc 121 atcccaaccc catgtaccag aggatgccgc tccttctgaa ccccaaattg ctcagcctgg 181 agtatccaag gaataacatt gaatatgtga gagacatcgg agagggagcg tttggaaggg 241 tgtttcaagc aagggcacca ggcttacttc cctatgaacc tttcactatg gtggcagtaa 301 agatgctcaa agaagaagcc tcggcagata tgcaagcgga ctttcagagg gaggcagccc 361 tcatggcaga atttgacaac cctaacattg tgaagctatt aggagtgtgt gctgtcggga 421 agccaatgtg cctgctcttt gaatacatgg cctatggtga cctcaatgag ttcctccgca 481 gcatgtcccc tcacaccgtg tgcagcctca gtcacagtga cttgtctatg agggctcagg 541 tctccagccc tgggccccca cccctctcct gtgctgagca gctttgcatt gccaggcagg 601 tggcagctgg catggcttac ctctcagaac gtaagtttgt tcaccgagat ttagccacca 661 ggaactgcct ggtgggcgag aacatggtgg tgaaaattgc cgactttggc ctctccagga 721 acatctactc agcagactac tacaaagcta atgaaaacga cgctatccct atccgttgga 781 tgccaccaga gtccattttt tataaccgct acactacaga gtctgatgtg tgggcctatg 841 gcgtggTCCT CTGGGAGATC TTCTCCTATG GCCTGCAGCC CTACTATGGG ATGGCCCATG 901 AGGAGGTCAT TTACTACGTG CGAGATGGCA ACATCCTCTC CTGCCCTGAG AACTGCCCCG 961 TGGAGCTGTA CAATCTCATG CGTCTATGTT GGAGCAAGCT GCCTGCAGAC AGACCCAGTT 1021 TCACCAGTAT TCACCGAATT CTGGAACGCA TGTGTGAGAG GGCAGAGGGA ACTGTGAGTG 1081 TCTAAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1141 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1201 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACAGTCTGCA TCGTGCCGCA TACGTACGCG 1261 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt