Construct: ORF TRCN0000488684
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020128.1_s317c1
- DNA Barcode:
- CACCCATTAGTAAGCCAGTTGCCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NEK6 (10783)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488684
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166168.1 | 97.6% | 97.7% | 1_21del;697C>T |
| 2 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166170.1 | 97.6% | 97.7% | 1_21del;697C>T |
| 3 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_014397.5 | 97.6% | 97.7% | 1_21del;697C>T |
| 4 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_005251664.1 | 97.6% | 97.7% | 1_21del;697C>T |
| 5 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_006716936.2 | 97.6% | 97.7% | 1_21del;697C>T |
| 6 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447386.1 | 97.6% | 97.7% | 1_21del;697C>T |
| 7 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447387.1 | 97.6% | 97.7% | 1_21del;697C>T |
| 8 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166167.1 | 92.3% | 92.4% | 1_75del;751C>T |
| 9 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166169.1 | 90.4% | 90.5% | 1_96del;772C>T |
| 10 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001145001.2 | 88% | 88.1% | 1_123del;799C>T |
| 11 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166171.1 | 88% | 88.1% | 1_123del;799C>T |
| 12 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_017014217.1 | 88% | 88.1% | 1_123del;799C>T |
| 13 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447385.1 | 82.3% | 82.4% | 1_195del;871C>T |
| 14 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | NM_001159631.1 | 86.5% | 93.2% | (many diffs) |
| 15 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | NM_021606.3 | 86.5% | 93.2% | (many diffs) |
| 16 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | XM_006498210.3 | 86.5% | 93.2% | (many diffs) |
| 17 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | XM_006498209.3 | 75.7% | 81.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 990
- ORF length:
- 918
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccccat ggagggagtt ccaacaacct ctgccacacc ctggggcctg 121 tgcatcctcc tgacccacag aggcatccca acacgctgtc ttttcgctgc tcgctggcgg 181 acttccagat cgaaaagaag ataggccgag gacagttcag cgaggtgtac aaggccacct 241 gcctgctgga caggaagaca gtggctctga agaaggtgca gatctttgag atgatggacg 301 ccaaggcgag gcaggactgt gtcaaggaga tcggcctctt gaagcaactg aaccacccaa 361 atatcatcaa gtatttggac tcgtttatcg aagacaacga gctgaacatt gtgctggagt 421 tggctgacgc aggggacctc tcgcagatga tcaagtactt taagaagcag aagcggctca 481 tcccggagag gacagtatgg aagtactttg tgcagctgtg cagcgccgtg gagcacatgc 541 attcacgccg ggtgatgcac cgagacatca agcctgccaa cgtgttcatc acagccacgg 601 gcgtcgtgaa gctcggtgac cttggtctgg gccgcttctt cagctctgag accaccgcag 661 cccactccct agtggggacg cccTACTACA TGTCACCGGA GAGGATCCAT GAGAACGGCT 721 ACAACTTCAA GTCCGACATC TGGTCCTTGG GCTGTCTGCT GTACGAGATG GCAGCCCTCC 781 AGAGCCCCTT CTATGGAGAT AAGATGAATC TCTTCTCCCT GTGCCAGAAG ATCGAGCAGT 841 GTGACTACCC CCCACTCCCC GGGGAGCACT ACTCCGAGAA GTTACGAGAA CTGGTCAGCA 901 TGTGCATCTG CCCTGACCCC CACCAGAGAC CTGACATCGG ATACGTGCAC CAGGTGGCCA 961 AGCAGATGCA CATCTGGATG TCCAGCACCT GAGACCCAGC TTTCTTGTAC AAAGTGGTTG 1021 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1081 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACA 1141 CCCATTAGTA AGCCAGTTGC CCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1201 ttgtgaaaga tt