Construct: ORF TRCN0000488773
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020621.1_s317c1
- DNA Barcode:
- GTGAGATCGTGGTGTCATCTTGTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NPR2 (4882)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488773
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | NM_003995.3 | 97.7% | 97.7% | 1814_1885del |
2 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_005251478.3 | 97.4% | 97.4% | 1436_1444delGTCCTTACA;1823_1894del |
3 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447557.1 | 93% | 92.9% | 1814_1885del;2048_2206del |
4 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447556.1 | 92.7% | 92.6% | 1436_1444delGTCCTTACA;1823_1894del;2057_2215del |
5 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447558.1 | 62.9% | 62.8% | (many diffs) |
6 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447561.1 | 53% | 53% | 0_1ins1404;410_481del |
7 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447560.1 | 50.4% | 50.3% | 0_1ins1404;410_481del;644_802del |
8 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447559.1 | 50.3% | 50.2% | (many diffs) |
9 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_173788.4 | 90.1% | 96.3% | (many diffs) |
10 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_001355466.1 | 87.7% | 93.9% | (many diffs) |
11 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | XR_390318.4 | 42.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 3141
- ORF length:
- 3069
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcgctg ccatcacttc tgctgttggt ggcagccctg gcaggtgggg 121 tgcgtcctcc cggggcgcgg aacctgacgc tggcggtggt gctgccagaa cacaacctga 181 gctatgcctg ggcctggcca cgggtgggac ccgctgtggc actagctgtg gaggctctgg 241 gccgggcact gcccgtggac ctgcggtttg tcagctccga actggaaggc gcctgctctg 301 agtacctggc accgctgagc gctgtggacc tcaagctgta ccatgacccc gacctgctgt 361 taggtcccgg ttgcgtgtac cctgctgcct ctgtggcccg ctttgcctcc cactggcgcc 421 ttcccctgct gactgcgggt gctgtggcct ctggtttttc ggctaagaat gaccattatc 481 gtaccctggt tcgcactggc ccctctgctc ccaagctggg tgagtttgtg gtgacactac 541 acgggcactt caattggact gcccgtgctg ccttgctgta cctggatgct cgcacagatg 601 accggcctca ctacttcacc atcgagggcg tctttgaggc cctgcagggc agcaacctca 661 gtgtgcagca ccaggtgtat gcccgagagc cagggggccc cgagcaggcc acccacttca 721 tccgggccaa cgggcgcatt gtgtatatct gcggccctct ggagatgctg catgagatcc 781 tgcttcaggc ccagagggag aatctgacca atggggatta tgtcttcttt tacctggatg 841 tctttgggga gagtctccgt gcaggcccca cacgtgctac aggccggccc tggcaggaca 901 atcgcacccg ggaacaggcc caggccctca gagaggcctt tcagactgta ttggtgatca 961 cgtaccgaga acccccaaat cctgagtatc aggaattcca gaatcgtctg ctgataagag 1021 cccgggaaga ctttggtgtg gagctgggcc cttccctgat gaacctcatc gctggctgct 1081 tctatgatgg gatcctgcta tatgctgaag tcctgaatga gacaatacag gaaggaggca 1141 cccgggagga tggacttcga attgtggaaa agatgcaggg acgaagatat cacggtgtaa 1201 ctgggctggt tgtcatggac aagaacaatg accgagagac tgactttgtc ctctgggcca 1261 tgggagacct ggattctggg gactttcagc ctgcagccca ctactcggga gctgagaagc 1321 agatttggtg gacgggacgg cctattccct gggtgaaggg ggctcctccc tcggacaatc 1381 ccccctgtgc ctttgacttg gacgacccat cctgtgataa aactccactt tcaaccctgg 1441 caattgtggc tctgggcaca ggaatcacct tcatcatgtt tggtgtttcc agcttcctaa 1501 ttttccgaaa gctgatgctg gagaaggagc tggctagcat gttgtggcgt attcgctggg 1561 aagaactgca gtttggcaac tcagagcgtt atcacaaagg tgcaggcagt cgcctcacac 1621 tgtcgctgcg gggatccagt tacggctcgc tcatgacagc ccatgggaaa taccagatct 1681 ttgccaacac cggtcacttc aagggaaatg ttgtcgccat caaacatgtg aataagaagc 1741 gcattgagct gacccggcag gttctgtttg aactcaaaca tatgagagat gttcagttca 1801 accatctcac tcgcttcatt ggcgcctgca tagaccctcc caacatttgc attgtcactg 1861 aatactgtcc tcgtgggagt ttacagggca tggcctttct ccacaacagc attatttcat 1921 cgcatgggag tctcaagtcc tccaactgtg tggtggatag tcgttttgtg ctcaaaatca 1981 cagactatgg cctggccagc ttccgatcaa ctgctgaacc tgatgacagc catgccctct 2041 atgccaagaa gctgtggact gccccagaac tgctcagtgg gaaccccttg ccaaccacag 2101 gcatgcagaa ggctgacgtc tatagctttg ggatcatcct gcaggagata gcacttcgca 2161 gtggtccttt ctacttggag ggcctggacc tcagccccaa agagattgtc cagaaggtac 2221 gaaatggtca gcggccatat ttccggccaa gcattgaccg gacccaactg aatgaagagc 2281 tagttttgct gatggagcga tgttgggctc aggacccagc tgagcggcca gactttggac 2341 agattaaggg cttcattcgg cgctttaaca aggagggtgg caccagcata ttggacaacc 2401 tcctgctgcg catggaacag tatgccaata acttggagaa gctggtggag gaacgcacac 2461 aggcctatct ggaggaaaaa cgcaaggctg aagctctgct ctaccaaatc ctaccccatt 2521 cagtggcaga gcagttaaaa cggggagaga ctgtacaggc tgaggccttt gacagtgtta 2581 ccatctactt cagtgacatt gttggcttca cagcattgtc agcagagagc acccccatgc 2641 aggtagtgac acttcttaat gacctgtata cctgctttga tgccataatt gacaactttg 2701 atgtctacaa ggtggagacg attggggatg cttacatggt ggtatctggc ctcccaggcc 2761 gaaatggtca acgccatgca ccagaaattg ctcGTATGGC CCTAGCATTA CTAGATGCAG 2821 TTTCTTCCTT TCGCATCCGC CACCGACCCC ATGACCAGCT GAGGCTACGC ATAGGGGTCC 2881 ATACTGGGCC AGTCTGTGCT GGGGTTGTTG GCCTGAAGAT GCCCCGTTAT TGTCTTTTTG 2941 GAGACACAGT GAACACTGCT TCTCGAATGG AGTCTAATGG TCAAGCGCTG AAGATCCATG 3001 TCTCCTCTAC CACCAAGGAT GCCCTAGATG AGCTAGGATG CTTCCAGCTA GAGCTTCGGG 3061 GGGATGTGGA AATGAAGGGA AAAGGAAAGA TGCGAACATA CTGGCTCTTA GGAGAGCGGA 3121 AAGGACCTCC TGGACTCCTG TAGAACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 3181 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 3241 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG TGAGATCGTG 3301 GTGTCATCTT GTAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 3361 att