Construct: ORF TRCN0000488785
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019826.1_s317c1
- DNA Barcode:
- AACGCGACCCGCAAATTTGATTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VIPR2 (7434)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488785
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_003382.5 | 99.8% | 99.7% | 393A>C;1314_1315insG |
| 2 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_005249561.3 | 92.8% | 90.8% | (many diffs) |
| 3 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_006716107.2 | 89.8% | 87% | (many diffs) |
| 4 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446914.1 | 85% | 74.4% | (many diffs) |
| 5 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446915.1 | 85% | 74.4% | (many diffs) |
| 6 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_001308259.1 | 83.2% | 76.3% | (many diffs) |
| 7 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_001304522.1 | 81.6% | 81.5% | 356_357ins240;1074_1075insG |
| 8 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446917.1 | 81.4% | 79.8% | (many diffs) |
| 9 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446916.1 | 79.5% | 78.4% | (many diffs) |
| 10 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_011516550.2 | 74.5% | 65.1% | (many diffs) |
| 11 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_006716108.3 | 72.5% | 68.4% | (many diffs) |
| 12 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_017012580.1 | 68.4% | 68.3% | 0_1ins414;900_901insG |
| 13 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446918.1 | 68.4% | 68.3% | 0_1ins414;900_901insG |
| 14 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NR_130758.1 | 30.7% | 1_186del;1330_1663del;1835_4278delinsG | |
| 15 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | NM_009511.2 | 81.5% | 85% | (many diffs) |
| 16 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_011244102.1 | 75.3% | 72.8% | (many diffs) |
| 17 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_006515806.3 | 72.4% | 75.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1386
- ORF length:
- 1317
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gcggacgctg ctgcctcccg cgctgctgac ctgctggctg ctcgcccccg 121 tgaacagcat tcacccagaa tgccgatttc atctggaaat acaggaggaa gaaacaaaat 181 gtgcagagct tctgaggtct caaacagaaa aacacaaagc ctgcagtggc gtctgggaca 241 acatcacgtg ctggcggcct gccaatgtgg gagagaccgt cacggtgccc tgcccaaaag 301 tcttcagcaa tttttacagc aaagcaggaa acataagcaa aaactgtacg agtgacggat 361 ggtcagagac gttcccagat ttcgtcgatg cctgtggcta cagcgacccg gaggatgaga 421 gcaagatcac gttttatatt ctggtgaagg ccatttatac cctgggctac agtgtctctc 481 tgatgtctct tgcaacagga agcataattc tgtgcctctt caggaagctg cactgcacca 541 ggaattacat ccacctgaac ctgttcctgt ccttcatcct gagagccatc tcagtgctgg 601 tcaaggacga cgttctctac tccagctctg gcacgttgca ctgccctgac cagccatcct 661 cctgggtggg ctgcaagctg agcctggtct tcctgcagta ctgcatcatg gccaacttct 721 tctggctgct ggtggagggg ctctacctcc acaccctcct ggtggccatg ctccccccta 781 gaaggtgctt cctggcctac ctcctgatcg gatggggcct ccccaccgtc tgcatcggtg 841 catggactgc ggccaggctc tacttagaag acaccggttg ctgggataca aacgaccaca 901 gtgtgccctg gtgggtcata cgaataccga ttttaatttc catcatcgtc aattttgtcc 961 ttttcattag tattatacga attttgctgc agaagttaac atccccagat gtcGGCGGCA 1021 ACGACCAGTC TCAGTACAAG AGGCTGGCCA AGTCCACGCT CCTGCTTATC CCGCTGTTCG 1081 GCGTCCACTA CATGGTGTTT GCCGTGTTTC CCATCAGCAT CTCCTCCAAA TACCAGATAC 1141 TGTTTGAGCT GTGCCTCGGG TCGTTCCAGG GCCTGGTGGT GGCCGTCCTC TACTGTTTCC 1201 TGAACAGTGA GGTGCAGTGC GAGCTGAAGC GAAAATGGCG AAGCCGGTGC CCGACCCCGT 1261 CCGCGAGCCG GGATTACAGG GTCTGCGGTT CCTCCTTCTC CCGCAACGGC TCGGAGGGCG 1321 CCCTGCAGTT CCACCGCGGC TCCCGCGCCC AGTCCTTCCT GCAAACGGAG ACCTCGGTCA 1381 TCGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1441 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1501 GGCTTTATAT ATCTTGTGGA AAGGACGAAA CGCGACCCGC AAATTTGATT CCACGCGTTA 1561 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt