Construct: ORF TRCN0000488876
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019440.1_s317c1
- DNA Barcode:
- AAGAGCCCCCTTGTGCCTCGTGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR176 (11245)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488876
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_001271854.2 | 99.8% | 99.4% | 230A>G;1255C>T;1542_1543insG |
| 2 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_007223.3 | 96.9% | 96.1% | (many diffs) |
| 3 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_011521167.3 | 89.5% | 84.3% | (many diffs) |
| 4 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_011521168.3 | 89.5% | 84.3% | (many diffs) |
| 5 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021873.2 | 89.5% | 84.3% | (many diffs) |
| 6 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_001271855.2 | 87.6% | 86.6% | (many diffs) |
| 7 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021874.2 | 68.3% | 68.1% | 0_1ins486;769C>T;1056_1057insG |
| 8 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021875.2 | 68.3% | 68.1% | 0_1ins486;769C>T;1056_1057insG |
| 9 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021876.1 | 68.3% | 68.1% | 0_1ins486;769C>T;1056_1057insG |
| 10 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021877.1 | 68.3% | 68.1% | 0_1ins486;769C>T;1056_1057insG |
| 11 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021878.2 | 68.3% | 68.1% | 0_1ins486;769C>T;1056_1057insG |
| 12 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_024449835.1 | 68.3% | 68.1% | 0_1ins486;769C>T;1056_1057insG |
| 13 | mouse | 381413 | Gpr176 | G protein-coupled receptor 176 | NM_201367.3 | 84% | 86.3% | (many diffs) |
| 14 | mouse | 381413 | Gpr176 | G protein-coupled receptor 176 | XM_011239648.2 | 74.9% | 78.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 63
- ORF end:
- 1608
- ORF length:
- 1545
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagcca 61 ccatgggaca taacgggagc tggatctctc caaatgccag cgagccgcac aacgcgtccg 121 gcgccgaggc tgcgggtgtg aaccgcagcg cgctcgggga gttcggcgag gcgcagctgt 181 accgccagtt caccaccacc gtgcaggtcg tcatcttcat aggctcgctg ctcgagtttg 241 gcaacatgga ggtcactaga aaacttgata agagcagact gcctgggatt aggttcatta 301 aaaacctggc ctgctcgggg atttgtgcca gcctggtctg tgtgcccttc gacatcatcc 361 tcagcaccag tcctcactgt tgctggtgga tctacaccat gctcttctgc aaggtcgtca 421 aatttttgca caaagtattc tgctctgtga ccatcctcag cttccctgct attgctttgg 481 acaggtacta ctcagtcctc tatccactgg agaggaaaat atctgatgcc aagtcccgtg 541 aactggtgat gtacatctgg gcccatgcag tggtggccag tgtccctgtg tttgcagtaa 601 ccaatgtggc tgacatctat gccacgtcca cctgcacgga agtctggagc aactccttgg 661 gccacctggt gtacgttctg gtgtataaca tcaccacggt cattgtgcct gtggtggtgg 721 tgttcctctt cttgatactg atccgacggg ccctgagtgc cagccagaag aagaaggtca 781 tcatagcagc gctccggacc ccacagaaca ccatctctat tccctatgcc tcccagcggg 841 aggccgagct gcacgccacc ctgctctcca tggtgatggt cttcatcttg tgtagcgtgc 901 cctatgccac cctggtcgtc taccagactg tgctcaatgt ccctgacact tccgtcttct 961 tgctgctcac tgctgtttgg ctgcccaaag tctccctgct ggcaaaccct gttctctttc 1021 ttactgtgaa caaatctgtc cgcaagtgct tgatagggac cctggtgcaa ctacaccacc 1081 ggtacagtcg ccgtaatgtg gtcagtacag ggagtggcat ggctgaggcc agcctggaac 1141 ccagcatacg ctcgggtagc cagctcctgg agatgttcca cattgggcag cagcagatct 1201 ttaagcccac agaggatgag gaagagagtg aggccaagta cattggctca gctgacttcC 1261 AGGCCAAGGA GATATTTAGC ACCTGCCTGG AGGGAGAGCA GGGGCCACAG TTTGCGTCCT 1321 CTGCCCCACC CCTGAGCACA GTGGACTCTG TATCCCAGGT GGCACCGGCA GCCCCTGTGG 1381 AACCTGAAAC ATTCCCTGAT AAGTATTCCC TGCAGTTTGG CTTTGGGCCT TTTGAGTTGC 1441 CTCCTCAGTG GCTCTCAGAG ACCCGAAACA GCAAGAAGCG GCTGCTTCCC CCCTTGGGCA 1501 ACACCCCAGA AGAGCTGATC CAGACAAAGG TGCCCAAGGT AGGCAGGGTG GAGCGGAAGA 1561 TGAGCAGAAA CAATAAAGTG AGCATTTTTC CAAAGGTGGA TTCCGACCCA GCTTTCTTGT 1621 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1681 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1741 GAAAGGACGA AAGAGCCCCC TTGTGCCTCG TGCCACGCGT TAAGTCgaca atcaacctct 1801 ggattacaaa atttgtgaaa gatt