Transcript: Human NM_007223.3

Homo sapiens G protein-coupled receptor 176 (GPR176), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
GPR176 (11245)
Length:
3912
CDS:
241..1788

Additional Resources:

NCBI RefSeq record:
NM_007223.3
NBCI Gene record:
GPR176 (11245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011488 CCTCTTTATTGAGGGAGTATA pLKO.1 1960 3UTR 100% 13.200 18.480 N GPR176 n/a
2 TRCN0000357062 TCGGAAACTTCATGGTGTTAT pLKO_005 410 CDS 100% 13.200 17.160 N GPR176 n/a
3 TRCN0000011492 CGTGTTCAAATCTGTCACCAA pLKO.1 450 CDS 100% 2.640 2.112 N GPR176 n/a
4 TRCN0000011490 CCACAGAACACCATCTCTATT pLKO.1 982 CDS 100% 13.200 9.240 N GPR176 n/a
5 TRCN0000357061 ATAACATCACCACGGTCATTG pLKO_005 866 CDS 100% 10.800 7.560 N GPR176 n/a
6 TRCN0000011491 GCGGAAGATGAGCAGAAACAA pLKO.1 1734 CDS 100% 5.625 3.938 N GPR176 n/a
7 TRCN0000011489 GCTCGGAAACTTCATGGTGTT pLKO.1 408 CDS 100% 4.050 2.835 N GPR176 n/a
8 TRCN0000368625 TTGGGCAGCAGCAGATCTTTA pLKO_005 1364 CDS 100% 13.200 7.920 N GPR176 n/a
9 TRCN0000220243 CAGAAACAATAAAGTGAGCAT pLKO.1 1746 CDS 100% 2.640 1.584 N Gpr176 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11615 pDONR223 100% 97.1% 96.5% None (many diffs) n/a
2 ccsbBroad304_11615 pLX_304 0% 97.1% 96.5% V5 (many diffs) n/a
3 TRCN0000472865 TACTCTGCCACCAAGTCTGACCAA pLX_317 28.8% 97.1% 96.5% V5 (many diffs) n/a
4 TRCN0000489805 AGGATTATCCTTTGAGTTTGTATC pLX_317 23.6% 97.1% 96.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488876 AAGAGCCCCCTTGTGCCTCGTGCC pLX_317 22.8% 96.9% 96.1% V5 (many diffs) n/a
Download CSV