Transcript: Human NM_001271854.2

Homo sapiens G protein-coupled receptor 176 (GPR176), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
GPR176 (11245)
Length:
3909
CDS:
241..1785

Additional Resources:

NCBI RefSeq record:
NM_001271854.2
NBCI Gene record:
GPR176 (11245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011488 CCTCTTTATTGAGGGAGTATA pLKO.1 1957 3UTR 100% 13.200 18.480 N GPR176 n/a
2 TRCN0000011490 CCACAGAACACCATCTCTATT pLKO.1 979 CDS 100% 13.200 9.240 N GPR176 n/a
3 TRCN0000357061 ATAACATCACCACGGTCATTG pLKO_005 863 CDS 100% 10.800 7.560 N GPR176 n/a
4 TRCN0000011491 GCGGAAGATGAGCAGAAACAA pLKO.1 1731 CDS 100% 5.625 3.938 N GPR176 n/a
5 TRCN0000368625 TTGGGCAGCAGCAGATCTTTA pLKO_005 1361 CDS 100% 13.200 7.920 N GPR176 n/a
6 TRCN0000220243 CAGAAACAATAAAGTGAGCAT pLKO.1 1743 CDS 100% 2.640 1.584 N Gpr176 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11615 pDONR223 100% 99.9% 99.8% None 230A>G n/a
2 ccsbBroad304_11615 pLX_304 0% 99.9% 99.8% V5 230A>G n/a
3 TRCN0000472865 TACTCTGCCACCAAGTCTGACCAA pLX_317 28.8% 99.9% 99.8% V5 230A>G n/a
4 TRCN0000489805 AGGATTATCCTTTGAGTTTGTATC pLX_317 23.6% 99.9% 99.8% V5 (not translated due to prior stop codon) 230A>G n/a
5 TRCN0000488876 AAGAGCCCCCTTGTGCCTCGTGCC pLX_317 22.8% 99.8% 99.4% V5 230A>G;1255C>T;1542_1543insG n/a
Download CSV