Transcript: Mouse XM_011239648.2

PREDICTED: Mus musculus G protein-coupled receptor 176 (Gpr176), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr176 (381413)
Length:
4446
CDS:
943..2313

Additional Resources:

NCBI RefSeq record:
XM_011239648.2
NBCI Gene record:
Gpr176 (381413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026850 GCCGCACAACAGTGTTCAAAT pLKO.1 962 CDS 100% 13.200 18.480 N Gpr176 n/a
2 TRCN0000220244 GTGGATCTATACGATGCTCTT pLKO.1 1089 CDS 100% 4.050 5.670 N Gpr176 n/a
3 TRCN0000011488 CCTCTTTATTGAGGGAGTATA pLKO.1 2458 3UTR 100% 13.200 10.560 N GPR176 n/a
4 TRCN0000220245 GTGTATGTTCTGATCTACAAT pLKO.1 1372 CDS 100% 5.625 3.938 N Gpr176 n/a
5 TRCN0000220242 GCTCTTCTTAACTGTGAACAA pLKO.1 1716 CDS 100% 4.950 3.465 N Gpr176 n/a
6 TRCN0000220243 CAGAAACAATAAAGTGAGCAT pLKO.1 2271 CDS 100% 2.640 1.584 N Gpr176 n/a
7 TRCN0000011490 CCACAGAACACCATCTCTATT pLKO.1 1504 CDS 100% 13.200 9.240 N GPR176 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11615 pDONR223 100% 75% 78.4% None (many diffs) n/a
2 ccsbBroad304_11615 pLX_304 0% 75% 78.4% V5 (many diffs) n/a
3 TRCN0000472865 TACTCTGCCACCAAGTCTGACCAA pLX_317 28.8% 75% 78.4% V5 (many diffs) n/a
4 TRCN0000489805 AGGATTATCCTTTGAGTTTGTATC pLX_317 23.6% 75% 78.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488876 AAGAGCCCCCTTGTGCCTCGTGCC pLX_317 22.8% 74.9% 78.1% V5 (many diffs) n/a
Download CSV