Construct: ORF TRCN0000488898
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020670.1_s317c1
- DNA Barcode:
- CAAAACAACTTTGGAACTACCTTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PRKACA (5566)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488898
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_002730.4 | 100% | 100% | |
| 2 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_207518.3 | 96.8% | 96% | (many diffs) |
| 3 | human | 5568 | PRKACG | protein kinase cAMP-activat... | NM_002732.3 | 85.4% | 82.9% | (many diffs) |
| 4 | human | 5566 | PRKACA | protein kinase cAMP-activat... | XM_017026948.1 | 84.3% | 84.3% | 760_761ins165 |
| 5 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_001304349.1 | 81.4% | 79.3% | (many diffs) |
| 6 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_006710758.2 | 73.8% | 88.5% | (many diffs) |
| 7 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_207578.3 | 55.6% | 68% | (many diffs) |
| 8 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001713.2 | 55.6% | 68% | (many diffs) |
| 9 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001300917.2 | 52.4% | 64.1% | (many diffs) |
| 10 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001718.2 | 52.4% | 64.1% | (many diffs) |
| 11 | mouse | 18747 | Prkaca | protein kinase, cAMP depend... | NM_008854.5 | 91.2% | 98% | (many diffs) |
| 12 | mouse | 18747 | Prkaca | protein kinase, cAMP depend... | NM_001277898.1 | 88.4% | 94% | (many diffs) |
| 13 | mouse | 18749 | Prkacb | protein kinase, cAMP depend... | NM_011100.4 | 78.3% | 92.3% | (many diffs) |
| 14 | mouse | 18749 | Prkacb | protein kinase, cAMP depend... | NM_001164199.1 | 75.5% | 88.6% | (many diffs) |
| 15 | mouse | 18749 | Prkacb | protein kinase, cAMP depend... | NM_001164198.1 | 75.3% | 88.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1125
- ORF length:
- 1053
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggcaac gccgccgccg ccaagaaggg cagcgagcag gagagcgtga 121 aagaattctt agccaaagcc aaagaagatt ttcttaaaaa atgggaaagt cccgctcaga 181 acacagccca cttggatcag tttgaacgaa tcaagaccct cggcacgggc tccttcgggc 241 gggtgatgct ggtgaaacac aaggagaccg ggaaccacta tgccatgaag atcctcgaca 301 aacagaaggt ggtgaaactg aaacagatcg aacacaccct gaatgaaaag cgcatcctgc 361 aagctgtcaa ctttccgttc ctcgtcaaac tcgagttctc cttcaaggac aactcaaact 421 tatacatggt catggagtac gtgcccggcg gggagatgtt ctcacaccta cggcggatcg 481 gaaggttcag tgagccccat gcccgtttct acgcggccca gatcgtcctg acctttgagt 541 atctgcactc gctggatctc atctacaggg acctgaagcc ggagaatctg ctcattgacc 601 agcagggcta cattcaggtg acagacttcg gtttcgccaa gcgcgtgaag ggccgcactt 661 ggaccttgtg cggcacccct gagtacctgg cccctgagat tatcctgagc aaaggctaca 721 acaaggccgt ggactggtgg gccctggggg ttcttatcta tgaaatggcc gctggctacc 781 cgcccttctt cgcagaccag cccatccaga tctatgagaa gatcgtctct gggaaggtgc 841 gcttcccttc ccacttcagc tctgacttga aggaccTGCT GCGGAACCTC CTGCAGGTAG 901 ATCTCACCAA GCGCTTTGGG AACCTCAAGA ATGGGGTCAA CGATATCAAG AACCACAAGT 961 GGTTTGCCAC AACTGACTGG ATTGCCATCT ACCAGAGGAA GGTGGAAGCT CCCTTCATAC 1021 CAAAGTTTAA AGGCCCTGGG GATACGAGTA ACTTTGACGA CTATGAGGAA GAAGAAATCC 1081 GGGTCTCCAT CAATGAGAAG TGTGGCAAGG AGTTTTCTGA GTTTTAGAAC CCAGCTTTCT 1141 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1201 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1261 GTGGAAAGGA CGACAAAACA ACTTTGGAAC TACCTTCACG CGTTAAGTCg acaatcaacc 1321 tctggattac aaaatttgtg aaagatt