Transcript: Human NM_207578.3

Homo sapiens protein kinase cAMP-activated catalytic subunit beta (PRKACB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PRKACB (5567)
Length:
1968
CDS:
248..1021

Additional Resources:

NCBI RefSeq record:
NM_207578.3
NBCI Gene record:
PRKACB (5567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002002 AGGAGTGCTAATCTATGAAAT pLKO.1 922 CDS 100% 13.200 18.480 N PRKACB n/a
2 TRCN0000002005 ACTCAGAATAATGCCGGACTT pLKO.1 350 CDS 100% 4.050 5.670 N PRKACB n/a
3 TRCN0000196664 GCTCAGATAGTGCTAACATTC pLKO.1 692 CDS 100% 10.800 7.560 N PRKACB n/a
4 TRCN0000196263 GAGCATACTTTGAATGAGAAA pLKO.1 506 CDS 100% 4.950 3.465 N PRKACB n/a
5 TRCN0000002003 CCTCCATTCACTAGACCTCAT pLKO.1 718 CDS 100% 4.050 2.835 N PRKACB n/a
6 TRCN0000194655 CTGAACAGTATTATGCCATGA pLKO.1 444 CDS 100% 4.050 2.835 N PRKACB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01278 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01278 pLX_304 86.8% 100% 100% V5 n/a
3 TRCN0000471379 CTTTCTAATGATGACAGCGATACC pLX_317 73.4% 99.7% 37.3% V5 (not translated due to prior stop codon) 276_277insA;763A>C n/a
4 ccsbBroadEn_06771 pDONR223 100% 72.9% 72.6% None (many diffs) n/a
5 ccsbBroad304_06771 pLX_304 63.7% 72.9% 72.6% V5 (many diffs) n/a
6 TRCN0000472524 AGTACGTGTTCTAGAGGGTTTGTA pLX_317 40% 72.9% 72.6% V5 (many diffs) n/a
7 ccsbBroadEn_14781 pDONR223 0% 72.9% 72.6% None (many diffs) n/a
8 ccsbBroad304_14781 pLX_304 18.9% 72.9% 72.6% V5 (many diffs) n/a
9 TRCN0000480324 TTTCTTACTCCGACTCGAACCGGA pLX_317 38.8% 72.9% 72.6% V5 (many diffs) n/a
10 ccsbBroadEn_14780 pDONR223 100% 55.3% 67.5% None (many diffs) n/a
11 ccsbBroad304_14780 pLX_304 0% 55.3% 67.5% V5 (many diffs) n/a
12 TRCN0000469004 AGCTCTTGCTTGTTTAGCGGTACG pLX_317 32.5% 55.3% 67.5% V5 (many diffs) n/a
13 TRCN0000488898 CAAAACAACTTTGGAACTACCTTC pLX_317 24.2% 55.6% 68% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV