Construct: ORF TRCN0000488926
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021641.1_s317c1
- DNA Barcode:
- TTATCGAGACCACCCAACCGAGGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- VDR (7421)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488926
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7421 | VDR | vitamin D receptor | NM_000376.3 | 99.2% | 99.2% | 1_9delATGGAGGCA |
| 2 | human | 7421 | VDR | vitamin D receptor | NM_001017535.1 | 99.2% | 99.2% | 1_9delATGGAGGCA |
| 3 | human | 7421 | VDR | vitamin D receptor | XM_006719587.3 | 99.2% | 99.2% | 1_9delATGGAGGCA |
| 4 | human | 7421 | VDR | vitamin D receptor | XM_011538720.2 | 99.2% | 99.2% | 1_9delATGGAGGCA |
| 5 | human | 7421 | VDR | vitamin D receptor | XM_024449178.1 | 94.2% | 94.2% | 1_78del |
| 6 | human | 7421 | VDR | vitamin D receptor | NM_001017536.2 | 88.8% | 88.8% | 1_159del |
| 7 | human | 7421 | VDR | vitamin D receptor | NM_001364085.1 | 85.8% | 99.2% | 1_9delATGGAGGCA;1282_1482del |
| 8 | mouse | 22337 | Vdr | vitamin D (1,25-dihydroxyvi... | NM_009504.4 | 85.4% | 87.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1344
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcggcc agcacttccc tgcctgaccc tggagacttt gaccggaacg 121 tgccccggat ctgtggggtg tgtggagacc gagccactgg ctttcacttc aatgctatga 181 cctgtgaagg ctgcaaaggc ttcttcaggc gaagcatgaa gcggaaggca ctattcacct 241 gccccttcaa cggggactgc cgcatcacca aggacaaccg acgccactgc caggcctgcc 301 ggctcaaacg ctgtgtggac atcggcatga tgaaggagtt cattctgaca gatgaggaag 361 tgcagaggaa gcgggagatg atcctgaagc ggaaggagga ggaggccttg aaggacagtc 421 tgcggcccaa gctgtctgag gagcagcagc gcatcattgc catactgctg gacgcccacc 481 ataagaccta cgaccccacc tactccgact tctgccagtt ccggcctcca gttcgtgtga 541 atgatggtgg agggagccat ccttccaggc ccaactccag acacactccc agcttctctg 601 gggactcctc ctcctcctgc tcagatcact gtatcacctc ttcagacatg atggactcgt 661 ccagcttctc caatctggat ctgagtgaag aagattcaga tgacccttct gtgaccctag 721 agctgtccca gctctccatg ctgccccacc tggctgacct ggtcagttac agcatccaaa 781 aggtcattgg ctttgctaag atgataccag gattcagaga cctcacctct gaggaccaga 841 tcgtactgct gaagtcaagt gccattgagg tcatcatgtt gcgctccaat gagtccttca 901 ccatggacga catgtcctgg acctgtggca accaagacta caagtaccgc gtcagtgacg 961 tgaccaaagc cggacacagc ctggagctga ttgagccccT CATCAAGTTC CAGGTGGGAC 1021 TGAAGAAGCT GAACTTGCAT GAGGAGGAGC ATGTCCTGCT CATGGCCATC TGCATCGTCT 1081 CCCCAGATCG TCCTGGGGTG CAGGACGCCG CGCTGATTGA GGCCATCCAG GACCGCCTGT 1141 CCAACACACT GCAGACGTAC ATCCGCTGCC GCCACCCGCC CCCGGGCAGC CACCTGCTCT 1201 ATGCCAAGAT GATCCAGAAG CTAGCCGACC TGCGCAGCCT CAATGAGGAG CACTCCAAGC 1261 AGTACCGCTG CCTCTCCTTC CAGCCTGAGT GCAGCATGAA GCTAACGCCC CTTGTGCTCG 1321 AAGTGTTTGG CAATGAGATC TCCTGAGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1381 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1441 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATTATCGAG 1501 ACCACCCAAC CGAGGCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1561 aagatt