Construct: ORF TRCN0000488978
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019187.1_s317c1
- DNA Barcode:
- TCGACATAAATAATATTCCAAATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RXFP1 (59350)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488978
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_021634.4 | 100% | 100% | |
| 2 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008518.2 | 99.8% | 99.8% | 1043_1044insCAG |
| 3 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532176.2 | 96.8% | 96.8% | 754_755ins72 |
| 4 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253727.1 | 96.5% | 96.4% | 287_367del |
| 5 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532174.1 | 96.4% | 96.3% | 287_367del;1124_1125insCAG |
| 6 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253728.2 | 95.6% | 95.5% | 187_188ins99 |
| 7 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253729.2 | 93.6% | 93.5% | 898_899ins144 |
| 8 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532175.1 | 93.4% | 93.3% | 287_367del;835_836ins72 |
| 9 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008517.1 | 93.3% | 93.2% | 287_367del;835_836ins72;1052_1053insCAG |
| 10 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001363776.1 | 89.2% | 89.2% | 0_1ins243 |
| 11 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008522.1 | 89.1% | 89.1% | 0_1ins243;800_801insCAG |
| 12 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008519.1 | 86.2% | 86% | 0_1ins243;44_124del |
| 13 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008520.1 | 86.2% | 86% | 0_1ins243;44_124del |
| 14 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253730.1 | 82.6% | 82.6% | 0_1ins390;653_654insCAG |
| 15 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253732.2 | 81.2% | 79.1% | (many diffs) |
| 16 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253733.1 | 78% | 75.9% | (many diffs) |
| 17 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008526.1 | 78% | 75.9% | (many diffs) |
| 18 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045584.2 | 66.7% | (many diffs) | |
| 19 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045581.2 | 61.2% | 1_95del;282_305del;2391_3710del | |
| 20 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045580.2 | 60.7% | 1_95del;282_334del;2420_3739del | |
| 21 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045583.2 | 56.5% | (many diffs) | |
| 22 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045582.2 | 56.1% | (many diffs) | |
| 23 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045579.2 | 49.7% | (many diffs) | |
| 24 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008523.2 | 49.6% | 49.4% | (many diffs) |
| 25 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532179.2 | 47.9% | 47.5% | (many diffs) |
| 26 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008524.2 | 46.5% | 46.2% | (many diffs) |
| 27 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008525.1 | 45.3% | 44.9% | (many diffs) |
| 28 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | NM_212452.1 | 85.9% | 85% | (many diffs) |
| 29 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | XM_006501629.2 | 85.7% | 84.9% | (many diffs) |
| 30 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | XM_006501630.2 | 71.8% | 71.8% | (many diffs) |
| 31 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | XR_375538.2 | 24.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 2346
- ORF length:
- 2271
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgaca tctggttctg tcttcttcta catcttaatt tttggaaaat 121 atttttctca tgggggtgga caggatgtca agtgctccct tggctatttc ccctgtggga 181 acatcacaaa gtgcttgcct cagctcctgc actgtaacgg tgtggacgac tgcgggaatc 241 aggccgatga ggacaactgt ggagacaaca atggatggtc tctgcaattt gacaaatatt 301 ttgccagtta ctacaaaatg acttcccaat atccttttga ggcagaaaca cctgaatgtt 361 tggtcggttc tgtgccagtg caatgtcttt gccaaggtct ggagcttgac tgtgatgaaa 421 ccaatttacg agctgttcca tcggtttctt caaatgtgac tgcaatgtca cttcagtgga 481 acttaataag aaagcttcct cctgattgct tcaagaatta tcatgatctt cagaagctgt 541 acctgcaaaa caataagatt acatccatct ccatctatgc tttcagagga ctgaatagcc 601 ttactaaact gtatctcagt cataacagaa taaccttcct gaagccgggt gtttttgaag 661 atcttcacag actagaatgg ctgataattg aagataatca cctcagtcga atttccccac 721 caacatttta tggactaaat tctcttattc tcttagtcct gatgaataac gtcctcaccc 781 gtttacctga taaacctctc tgtcaacaca tgccaagact acattggctg gaccttgaag 841 gcaaccatat ccataattta agaaatttga cttttatttc ctgcagtaat ttaactgttt 901 tagtgatgag gaaaaacaaa attaatcact taaatgaaaa tacttttgca cctctccaga 961 aactggatga attggattta ggaagtaata agattgaaaa tcttccaccg cttatattca 1021 aggacctgaa ggagctgtca caattgaatc tttcctataa tccaatccag aaaattcaag 1081 caaaccaatt tgattatctt gtcaaactca agtctctcag cctagaaggg attgaaattt 1141 caaatatcca acaaaggatg tttagacctc ttatgaatct ctctcacata tattttaaga 1201 aattccagta ctgtgggtat gcaccacatg ttcgcagctg taaaccaaac actgatggaa 1261 tttcatctct agagaatctc ttggcaagca ttattcagag agtatttgtc tgggttgtat 1321 ctgcagttac ctgctttgga aacatttttg tcatttgcat gcgaccttat atcaggtctg 1381 agaacaagct gtatgccatg tcaatcattt ctctctgctg tgccgactgc ttaatgggaa 1441 tatatttatt cgtgatcgga ggctttgacc taaagtttcg tggagaatac aataagcatg 1501 cgcagctgtg gatggagagt actcattgtc agcttgtagg atctttggcc attctgtcca 1561 cagaagtatc agttttactg ttaacatttc tgacattgga aaaatacatc tgcattgtct 1621 atccttttag atgtgtgaga cctggaaaat gcagaacaat tacagttctg attctcattt 1681 ggattactgg ttttatagtg gctttcattc cattgagcaa taaggaattt ttcaaaaact 1741 actatggcac caatggagta tgcttccctc ttcattcaga agatacagaa agtattggag 1801 cccagattta ttcagtggca atttttcttg gtattaattt ggccgcattt atcatcatag 1861 ttttttccta tggaagcatg ttttatagtg ttcatcaaag tgccataaca gcaactgaaa 1921 tacggaatca agttaaaaaa gagatgatcc ttgccaaacg ttttttcttt atagtattta 1981 ctgatgcatt atgctGGATA CCCATTTTTG TAGTGAAATT TCTTTCACTG CTTCAGGTAG 2041 AAATACCAGG TACCATAACC TCTTGGGTAG TGATTTTTAT TCTGCCCATT AACAGTGCTT 2101 TGAACCCAAT TCTCTATACT CTGACCACAA GACCATTTAA AGAAATGATT CATCGGTTTT 2161 GGTATAACTA CAGACAAAGA AAATCTATGG ACAGCAAAGG TCAGAAAACA TATGCTCCAT 2221 CATTCATCTG GGTGGAAATG TGGCCACTGC AGGAGATGCC ACCTGAGTTA ATGAAGCCGG 2281 ACCTTTTCAC ATACCCCTGT GAAATGTCAC TGATTTCTCA ATCAACGAGA CTCAATTCCT 2341 ATTCAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 2401 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2461 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATCGACATAA ATAATATTCC AAATAACGCG 2521 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt