Transcript: Mouse NM_212452.1

Mus musculus relaxin/insulin-like family peptide receptor 1 (Rxfp1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rxfp1 (381489)
Length:
2277
CDS:
1..2277

Additional Resources:

NCBI RefSeq record:
NM_212452.1
NBCI Gene record:
Rxfp1 (381489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_212452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125559 GCTCCGTAACAGTAACCGAAA pLKO.1 1826 CDS 100% 4.050 5.670 N Rxfp1 n/a
2 TRCN0000125561 GCCTATCAACAGTGCTTTGAA pLKO.1 2010 CDS 100% 5.625 4.500 N Rxfp1 n/a
3 TRCN0000125563 CTCTGGCACAACTACAGACAA pLKO.1 2083 CDS 100% 4.950 3.960 N Rxfp1 n/a
4 TRCN0000125562 CCACCGAACATATTTAAGGAT pLKO.1 931 CDS 100% 3.000 2.100 N Rxfp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_212452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03880 pDONR223 100% 85.9% 85% None (many diffs) n/a
2 ccsbBroad304_03880 pLX_304 0% 85.9% 85% V5 (many diffs) n/a
3 TRCN0000469306 AACGATTACCCTCGTCGGAACCGT pLX_317 15.4% 85.9% 85% V5 (many diffs) n/a
4 TRCN0000488978 TCGACATAAATAATATTCCAAATA pLX_317 15.6% 85.9% 85% V5 (many diffs) n/a
5 TRCN0000489641 TGAGCCTACTCTGCAACGTGAGTC pLX_317 19.6% 85.9% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV