Construct: ORF TRCN0000489010
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020125.1_s317c1
- DNA Barcode:
- CATAGGTAGGCGTCCACATGACTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AK5 (26289)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489010
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001010.2 | 38.4% | 38.4% | 1_945del |
2 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001011.2 | 38.4% | 38.4% | 1_945del |
3 | human | 26289 | AK5 | adenylate kinase 5 | NM_012093.4 | 36.7% | 36.7% | 1_1017del |
4 | human | 26289 | AK5 | adenylate kinase 5 | XM_006710572.3 | 36.7% | 36.7% | 1_1017del |
5 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001008.2 | 36.7% | 36.7% | 1_1017del |
6 | human | 26289 | AK5 | adenylate kinase 5 | XM_017001009.1 | 36.7% | 36.7% | 1_1017del |
7 | human | 26289 | AK5 | adenylate kinase 5 | XM_005270739.5 | 36.6% | 36.6% | 1_1023del |
8 | human | 26289 | AK5 | adenylate kinase 5 | NM_174858.3 | 35% | 35% | 1_1095del |
9 | mouse | 229949 | Ak5 | adenylate kinase 5 | NM_001081277.1 | 30.4% | 30.4% | (many diffs) |
10 | mouse | 229949 | Ak5 | adenylate kinase 5 | XM_011240115.2 | 29.3% | 27.3% | (many diffs) |
11 | mouse | 229949 | Ak5 | adenylate kinase 5 | XM_006501440.3 | 27% | 27% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 663
- ORF length:
- 591
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggaggt ttcatggaag atttgagaaa gtgtaaaatt attttcataa 121 ttggtggtcc tggctctggc aaaggcacac agtgtgaaaa gctggtggaa aaatatggat 181 ttacacatct ctcaactggc gagctcctgc gtgaggaact ggcatcagaa tctgaaagaa 241 gcaaattgat cagagacatt atggaacgtg gagacctggt gccctcaggc atcgttttgg 301 agctcctgaa ggaggccatg gtggccagcc tcggggacac caggggcttc cTGATTGACG 361 GCTATCCTCG GGAGGTGAAG CAAGGGGAAG AGTTCGGACG CAGGATTGGA GACCCACAGT 421 TGGTGATCTG TATGGACTGC TCGGCAGACA CCATGACCAA CCGCCTTCTC CAAAGGAGCC 481 GGAGCAGCCT GCCTGTGGAC GACACCACCA AGACCATCGC CAAGCGCCTA GAAGCCTACT 541 ACCGAGCGTC CATCCCCGTG ATCGCCTACT ACGAGACAAA AACACAGCTA CACAAGATAA 601 ATGCAGAGGG AACACCAGAG GACGTTTTTC TTCAACTCTG CACAGCTATT GACTCTATTT 661 TCTGAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 721 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 781 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACATAGGTAG GCGTCCACAT GACTAACGCG 841 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt