Construct: ORF TRCN0000489018
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019566.1_s317c1
- DNA Barcode:
- TGACCTCGTGACCAGCTTGGGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- INPP5K (51763)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489018
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | NM_016532.4 | 100% | 100% | |
| 2 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | NM_001135642.2 | 83% | 83% | 0_1ins228 |
| 3 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | NM_130766.3 | 83% | 83% | 0_1ins228 |
| 4 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_005256683.2 | 83% | 83% | 0_1ins228 |
| 5 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_011523934.1 | 83% | 83% | 0_1ins228 |
| 6 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_017024756.1 | 83% | 83% | 0_1ins228 |
| 7 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_024450802.1 | 83% | 83% | 0_1ins228 |
| 8 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_005256685.1 | 79.4% | 79.4% | 0_1ins276 |
| 9 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_005256686.2 | 79.4% | 79.4% | 0_1ins276 |
| 10 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_017024757.2 | 79.4% | 79.4% | 0_1ins276 |
| 11 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_011523936.2 | 68.6% | 60.9% | 0_1ins415;140_149delGTGAGCCTGG |
| 12 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_017024758.2 | 68.6% | 60.9% | 0_1ins415;140_149delGTGAGCCTGG |
| 13 | human | 51763 | INPP5K | inositol polyphosphate-5-ph... | XM_017024759.1 | 68.6% | 60.9% | 0_1ins415;140_149delGTGAGCCTGG |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 93
- ORF end:
- 1437
- ORF length:
- 1344
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatccg 61 cggccgcccc cttcaccgaa ttcacggcgg ccatgagctc gcggaagctg agcgggccga 121 aaggcaggag gctcagcata cacgtcgtga cttggaacgt ggcttcggca gcgccccctc 181 tagatctcag tgacctgctt cagctgaaca accggaacct caatcttgac atatatgtta 241 ttggtttgca ggaattgaac tctgggatca taagcctcct ttccgatgct gcctttaatg 301 actcgtggag cagtttcctc atggatgtgc tttcccctct gagcttcatc aaggtctccc 361 atgtccgtat gcaggggatc ctcttactgg tctttgccaa gtatcagcat ttgccctata 421 tccagattct gtctactaaa tccaccccca ctggcctgtt tgggtactgg gggaacaaag 481 gtggagtcaa catctgcctg aagctttatg gctactatgt cagcatcatc aactgccacc 541 tgcctcccca catttccaac aattaccagc ggctggagca ctttgaccgg atcctggaga 601 tgcagaattg tgaggggcga gacatcccaa acatcctgga ccacgacctc attatctggt 661 ttggagacat gaactttcgg atcgaggact ttgggttgca ctttgttcgg gaatccatta 721 aaaatcggtg ctacggtggc ctgtgggaga aggaccagct cagcattgcc aagaaacatg 781 acccgctgct ccgggagttc caggagggcc gcctactctt cccgcccacc tacaagtttg 841 ataggaactc caacgactat gacaccagtg agaaaaaacg caagcctgca tggaccgatc 901 gcatcctgtg gaggctgaag cggcagccct gtgctggccc cgacactccc ataccgccgg 961 cgtcacactt ctccttgtct ctgaggggct acagcagcca catgacgtac ggcatcagcg 1021 accacaagcc tgtctccggc acgttcgact tggagctgaa gccattggtg tctgctccgc 1081 tgatcgtcct gatgcccgag gaccTGTGGA CCGTGGAAAA TGACATGATG GTCAGCTACT 1141 CTTCAACCTC GGACTTCCCC AGCAGCCCGT GGGACTGGAT TGGACTGTAC AAGGTGGGGC 1201 TGCGGGACGT TAATGACTAC GTGTCCTATG CCTGGGTCGG GGACAGCAAG GTCTCCTGCA 1261 GCGACAACCT GAACCAGGTT TACATCGACA TCAGCAATAT CCCTACCACT GAAGATGAGT 1321 TTCTCCTCTG TTACTACAGC AACAGTCTGC GTTCTGTGGT GGGGATAAGC AGACCCTTCC 1381 AGATCCCGCC TGGCTCCTTG AGGGAGGACC CACTGGGTGA AGCACAGCCA CAGATCAAGG 1441 GTGGGCGCGC CGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1501 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1561 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATGA CCTCGTGACC AGCTTGGGGA 1621 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t