Transcript: Human XM_017024757.2

PREDICTED: Homo sapiens inositol polyphosphate-5-phosphatase K (INPP5K), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INPP5K (51763)
Length:
2997
CDS:
679..1749

Additional Resources:

NCBI RefSeq record:
XM_017024757.2
NBCI Gene record:
INPP5K (51763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052706 CTACTCTTCAACCTCGGACTT pLKO.1 1446 CDS 100% 4.050 3.240 N INPP5K n/a
2 TRCN0000359308 TCTGGAATTAGCCGCTTAAAT pLKO_005 1926 3UTR 100% 15.000 10.500 N INPP5K n/a
3 TRCN0000359307 CTTTGTTCGGGAATCCATTAA pLKO_005 1011 CDS 100% 13.200 9.240 N INPP5K n/a
4 TRCN0000359305 GGACAGTTCTGCGTCTCATTT pLKO_005 2008 3UTR 100% 13.200 9.240 N INPP5K n/a
5 TRCN0000052704 CCCTACCACTGAAGATGAGTT pLKO.1 1611 CDS 100% 4.950 3.465 N INPP5K n/a
6 TRCN0000052707 CCTGAAGCTTTATGGCTACTA pLKO.1 807 CDS 100% 4.950 3.465 N INPP5K n/a
7 TRCN0000052703 CGGAACCTCAATCTTGACATA pLKO.1 632 5UTR 100% 4.950 3.465 N INPP5K n/a
8 TRCN0000174227 CGGAACCTCAATCTTGACATA pLKO.1 632 5UTR 100% 4.950 3.465 N INPP5K n/a
9 TRCN0000052705 CCACGACCTCATTATCTGGTT pLKO.1 951 CDS 100% 2.640 1.848 N INPP5K n/a
10 TRCN0000359375 TATCAGCATTTGCCCTATATC pLKO_005 712 CDS 100% 13.200 7.920 N INPP5K n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03381 pDONR223 100% 79.4% 79.4% None 0_1ins276 n/a
2 ccsbBroad304_03381 pLX_304 0% 79.4% 79.4% V5 0_1ins276 n/a
3 TRCN0000479107 ACCGGGCTTGTTAAATATAATTAT pLX_317 25.6% 79.4% 79.4% V5 0_1ins276 n/a
4 TRCN0000489018 TGACCTCGTGACCAGCTTGGGGAT pLX_317 25.4% 79.4% 79.4% V5 0_1ins276 n/a
Download CSV