Construct: ORF TRCN0000489019
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019515.1_s317c1
- DNA Barcode:
- AAGGGCCGCAATAAAGATTCGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPSR1 (387129)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489019
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_207172.2 | 99.8% | 99.4% | 723C>G;1113_1114insG |
| 2 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_207173.2 | 92.6% | 88.8% | (many diffs) |
| 3 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_001300933.2 | 89.8% | 86% | (many diffs) |
| 4 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_001300935.1 | 88% | 86.9% | 723C>G;1024_1123del;1170_1171ins44 |
| 5 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_001300934.1 | 82% | 81.7% | 278_279ins198;525C>G;915_916insG |
| 6 | mouse | 319239 | Npsr1 | neuropeptide S receptor 1 | NM_175678.3 | 86.6% | 88.7% | (many diffs) |
| 7 | mouse | 319239 | Npsr1 | neuropeptide S receptor 1 | XM_017313417.1 | 86.6% | 88.7% | (many diffs) |
| 8 | mouse | 319239 | Npsr1 | neuropeptide S receptor 1 | XM_017313418.1 | 51.6% | 53.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 63
- ORF end:
- 1179
- ORF length:
- 1116
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagcca 61 ccatgccagc caacttcaca gagggcagct tcgattccag tgggaccggg cagacgctgg 121 attcttcccc agtggcttgc actgaaacag tgacttttac tgaagtggtg gaaggaaagg 181 aatggggttc cttctactac tcctttaaga ctgagcaatt gataactctg tgggtcctct 241 ttgtttttac cattgttgga aactccgttg tgcttttttc cacatggagg agaaagaaga 301 agtcaagaat gaccttcttt gtgactcagc tggccatcac agattctttc acaggactgg 361 tcaacatctt gacagatatt aattggcgat tcactggaga cttcacggca cctgacctgg 421 tttgccgagt ggtccgctat ttgcaggttg tgctgctcta cgcctctacc tacgtcctgg 481 tgtccctcag catagacaga taccatgcca tcgtctaccc catgaagttc cttcaaggag 541 aaaagcaagc cagggtcctc attgtgatcg cctggagcct gtcttttctg ttctccattc 601 ccaccctgat catatttggg aagaggacac tgtccaacgg tgaagtgcag tgctgggccc 661 tgtggcctga cgactcctac tggaccccat acatgaccat cgtggccttc ctggtgtact 721 tcatccctct gacaatcatc agcatcatgt atggcattgt gatccgaact atttggatta 781 aaaggaaaac ctacgaaaca gtgatttcca actgctcaga tgggaaactg tgcagcagct 841 ataaccgagg actcaTCTCA AAGGCAAAAA TCAAGGCTAT CAAGTATAGC ATCATCATCA 901 TTCTTGCCTT CATCTGCTGT TGGAGTCCAT ACTTCCTGTT TGACATTTTG GACAATTTCA 961 ACCTCCTTCC AGACACCCAG GAGCGTTTCT ATGCCTCTGT GATCATTCAG AACCTGCCAG 1021 CATTGAATAG TGCCATCAAC CCCCTCATCT ACTGTGTCTT CAGCAGCTCC ATCTCTTTCC 1081 CCTGCAGGGA GCAAAGATCA CAGGATTCCA GAATGACGTT CCGGGAGAGA ACTGAGAGGC 1141 ATGAGATGCA GATTCTGTCC AAGCCAGAAT TCATCGACCC AGCTTTCTTG TACAAAGTGG 1201 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1261 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1321 AAAGGGCCGC AATAAAGATT CGCCAACGCG TTAAGTCgac aatcaacctc tggattacaa 1381 aatttgtgaa agatt