Transcript: Human NM_001300935.1

Homo sapiens neuropeptide S receptor 1 (NPSR1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
NPSR1 (387129)
Length:
1713
CDS:
175..1347

Additional Resources:

NCBI RefSeq record:
NM_001300935.1
NBCI Gene record:
NPSR1 (387129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363245 TTGCCGAGTGGTCCGCTATTT pLKO_005 534 CDS 100% 13.200 18.480 N NPSR1 n/a
2 TRCN0000063361 GCGTTTCTATGCCTCTGTGAT pLKO.1 1095 CDS 100% 4.950 6.930 N NPSR1 n/a
3 TRCN0000063358 GCCAGCATTGAATAGTGCCAT pLKO.1 1128 CDS 100% 2.640 3.696 N NPSR1 n/a
4 TRCN0000360161 ATCCGAACTATTTGGATTAAA pLKO_005 874 CDS 100% 15.000 10.500 N NPSR1 n/a
5 TRCN0000363314 ATTCCCACCCTGATCATATTT pLKO_005 709 CDS 100% 15.000 10.500 N NPSR1 n/a
6 TRCN0000360169 CAACATCTTGACAGATATTAA pLKO_005 474 CDS 100% 15.000 10.500 N NPSR1 n/a
7 TRCN0000063360 GCTGGCCATCACAGATTCTTT pLKO.1 441 CDS 100% 5.625 3.938 N NPSR1 n/a
8 TRCN0000063362 GAGAGGCATGAGATGCAGATT pLKO.1 1346 CDS 100% 4.950 3.465 N NPSR1 n/a
9 TRCN0000063359 CCCTCTGACAATCATCAGCAT pLKO.1 837 CDS 100% 2.640 1.848 N NPSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05564 pDONR223 100% 91.4% 87.5% None (many diffs) n/a
2 ccsbBroad304_05564 pLX_304 0% 91.4% 87.5% V5 (many diffs) n/a
3 TRCN0000479206 CGGAATGTGATGCCCCCCCGGCCG pLX_317 35.7% 91.4% 87.5% V5 (many diffs) n/a
4 TRCN0000489019 AAGGGCCGCAATAAAGATTCGCCA pLX_317 29.2% 88% 86.9% V5 723C>G;1024_1123del;1170_1171ins44 n/a
5 TRCN0000489490 TTTTGACGCGAGCAACACGAGGTC pLX_317 23.4% 88% 84.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV