Transcript: Mouse XM_017313417.1

PREDICTED: Mus musculus neuropeptide S receptor 1 (Npsr1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npsr1 (319239)
Length:
1746
CDS:
251..1366

Additional Resources:

NCBI RefSeq record:
XM_017313417.1
NBCI Gene record:
Npsr1 (319239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028171 CGCCTTGAACAGTGCCATTAA pLKO.1 1207 CDS 100% 13.200 18.480 N Npsr1 n/a
2 TRCN0000438661 GGCCTTGTGATCCGAACTATT pLKO_005 941 CDS 100% 13.200 18.480 N Npsr1 n/a
3 TRCN0000028138 CCTTGGCAATTATCAGCGTTA pLKO.1 915 CDS 100% 4.050 5.670 N Npsr1 n/a
4 TRCN0000028213 GCATCGTCATAATCCTTGCTT pLKO.1 1077 CDS 100% 3.000 4.200 N Npsr1 n/a
5 TRCN0000063361 GCGTTTCTATGCCTCTGTGAT pLKO.1 1171 CDS 100% 4.950 3.960 N NPSR1 n/a
6 TRCN0000432632 TGCCTCACCTAGCAGATATAT pLKO_005 1469 3UTR 100% 15.000 10.500 N Npsr1 n/a
7 TRCN0000028160 CCCAGTAGCTTGCACTGAAAT pLKO.1 316 CDS 100% 13.200 9.240 N Npsr1 n/a
8 TRCN0000421948 GCTATCCCTGAGTCATCTAAT pLKO_005 1695 3UTR 100% 13.200 9.240 N Npsr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489019 AAGGGCCGCAATAAAGATTCGCCA pLX_317 29.2% 86.6% 88.7% V5 (many diffs) n/a
2 TRCN0000489490 TTTTGACGCGAGCAACACGAGGTC pLX_317 23.4% 86.6% 88.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_05564 pDONR223 100% 82.1% 81.6% None (many diffs) n/a
4 ccsbBroad304_05564 pLX_304 0% 82.1% 81.6% V5 (many diffs) n/a
5 TRCN0000479206 CGGAATGTGATGCCCCCCCGGCCG pLX_317 35.7% 82.1% 81.6% V5 (many diffs) n/a
Download CSV