Transcript: Mouse XM_017313418.1

PREDICTED: Mus musculus neuropeptide S receptor 1 (Npsr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npsr1 (319239)
Length:
4580
CDS:
147..803

Additional Resources:

NCBI RefSeq record:
XM_017313418.1
NBCI Gene record:
Npsr1 (319239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028171 CGCCTTGAACAGTGCCATTAA pLKO.1 644 CDS 100% 13.200 18.480 N Npsr1 n/a
2 TRCN0000438661 GGCCTTGTGATCCGAACTATT pLKO_005 378 CDS 100% 13.200 18.480 N Npsr1 n/a
3 TRCN0000028138 CCTTGGCAATTATCAGCGTTA pLKO.1 352 CDS 100% 4.050 5.670 N Npsr1 n/a
4 TRCN0000028213 GCATCGTCATAATCCTTGCTT pLKO.1 514 CDS 100% 3.000 4.200 N Npsr1 n/a
5 TRCN0000063361 GCGTTTCTATGCCTCTGTGAT pLKO.1 608 CDS 100% 4.950 3.960 N NPSR1 n/a
6 TRCN0000432632 TGCCTCACCTAGCAGATATAT pLKO_005 906 3UTR 100% 15.000 10.500 N Npsr1 n/a
7 TRCN0000421948 GCTATCCCTGAGTCATCTAAT pLKO_005 1132 3UTR 100% 13.200 9.240 N Npsr1 n/a
8 TRCN0000028153 CCCATGTTTGAGGAGACAGAA pLKO.1 2274 3UTR 100% 4.950 3.465 N Npsr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489490 TTTTGACGCGAGCAACACGAGGTC pLX_317 23.4% 51.7% 53.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489019 AAGGGCCGCAATAAAGATTCGCCA pLX_317 29.2% 51.6% 53.2% V5 (many diffs) n/a
Download CSV