Construct: ORF TRCN0000489062
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021297.1_s317c1
- DNA Barcode:
- TTACTTTCTCGCGTAATCCAAACG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CPA2 (1358)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489062
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1358 | CPA2 | carboxypeptidase A2 | NM_001869.3 | 99.3% | 99.2% | 1_6delATGGCC;245A>G;633T>C |
| 2 | mouse | 232680 | Cpa2 | carboxypeptidase A2, pancre... | NM_001024698.3 | 85.5% | 86% | (many diffs) |
| 3 | mouse | 232680 | Cpa2 | carboxypeptidase A2, pancre... | XM_011241057.1 | 65.6% | 67.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1323
- ORF length:
- 1251
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaggttg atcctgtttt ttggtgccct ttttgggcat atctactgtc 121 tagaaacatt tgtgggagac caagttcttg agattgtacc aagcaatgaa gaacaaatta 181 aaaatctgct acaattggag gctcaagaac atctccagct tgatttttgg aaatcaccca 241 ccaccccagg ggagacagcc cacgtccgag ttcccttcgt caacgtccag gcagtcaaag 301 tgttcttggg gtcccaggga attgcctatt ccatcatgat tgaagacgtg caggtcctgt 361 tggacaaaga gaatgaagaa atgcttttta ataggagaag agaacggagt ggtaacttca 421 attttggggc ctaccatacc ctggaagaga tttcccaaga aatggataac ctcgtggctg 481 agcaccctgg tctagtgagc aaagtgaata ttggctcttc ttttgagaac cggcctatga 541 acgtgctcaa gttcagcacc ggaggagaca agccagctat ctggctggat gctgggatcc 601 atgctcgaga gtgggttaca caagctacgg cactttggac agcaaataag attgtttctg 661 attatggaaa ggacccatcc atcacttcca ttctggacgc cctggatatc ttcctcctgc 721 cagtcacaaa ccctgatgga tacgtgttct ctcaaaccaa aaatcgtatg tggcggaaga 781 cccggtccaa ggtatctgga agcctctgtg ttggtgtgga tcctaaccgg aactgggatg 841 caggttttgg aggacctgga gccagcagca acccttgctc tgattcatac cacggaccca 901 gtgccaactc tgaagttgaa gtgaaatcca tagtggactt catcaagagt catggaaaag 961 tcaaggCCTT CATTACCCTC CACAGCTATT CCCAGCTGCT GATGTTCCCC TATGGGTACA 1021 AATGTACCAA GTTAGATGAC TTTGATGAGC TGAGTGAAGT GGCCCAAAAG GCTGCCCAAT 1081 CTCTGAGAAG CCTGCATGGC ACCAAGTACA AAGTGGGACC AATCTGCTCT GTCATCTACC 1141 AAGCCAGTGG AGGAAGCATT GACTGGTCCT ATGATTATGG CATCAAGTAC TCATTTGCCT 1201 TTGAACTGAG AGACACAGGG CGCTACGGCT TCCTCTTGCC AGCCCGTCAG ATCCTGCCCA 1261 CAGCCGAGGA GACCTGGCTT GGCTTGAAGG CAATCATGGA GCATGTGCGA GACCACCCCT 1321 ATTAGAACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1381 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1441 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATTACTTTCT CGCGTAATCC AAACGACGCG 1501 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt