Transcript: Human NM_001869.3

Homo sapiens carboxypeptidase A2 (CPA2), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CPA2 (1358)
Length:
1330
CDS:
20..1279

Additional Resources:

NCBI RefSeq record:
NM_001869.3
NBCI Gene record:
CPA2 (1358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046842 GCCTATGAACGTGCTCAAGTT pLKO.1 487 CDS 100% 4.950 6.930 N CPA2 n/a
2 TRCN0000086857 TGGTCTAGTGAGCAAAGTGAA pLKO.1 442 CDS 100% 4.950 6.930 N Cpa2 n/a
3 TRCN0000046838 CCAAGTACAAAGTGGGACCAA pLKO.1 1056 CDS 100% 2.640 3.696 N CPA2 n/a
4 TRCN0000046839 CCAGGGAATTGCCTATTCCAT pLKO.1 268 CDS 100% 0.300 0.420 N CPA2 n/a
5 TRCN0000371887 ACGGAGTGGTAACTTCAATTT pLKO_005 358 CDS 100% 13.200 9.240 N CPA2 n/a
6 TRCN0000371828 TATGGCATCAAGTACTCATTT pLKO_005 1130 CDS 100% 13.200 9.240 N CPA2 n/a
7 TRCN0000371827 TCAACGTCCAGGCAGTCAAAG pLKO_005 234 CDS 100% 10.800 7.560 N CPA2 n/a
8 TRCN0000046841 TGTACCAAGTTAGATGACTTT pLKO.1 977 CDS 100% 4.950 3.465 N CPA2 n/a
9 TRCN0000046840 GCAAAGTGAATATTGGCTCTT pLKO.1 453 CDS 100% 4.050 2.835 N CPA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489062 TTACTTTCTCGCGTAATCCAAACG pLX_317 28.9% 99.3% 99.2% V5 (not translated due to prior stop codon) 1_6delATGGCC;245A>G;633T>C n/a
2 ccsbBroadEn_10424 pDONR223 100% 99.2% 99.2% None (many diffs) n/a
3 ccsbBroad304_10424 pLX_304 0% 99.2% 99.2% V5 (many diffs) n/a
4 TRCN0000491406 AAAGCCTTCCTATATTCCAACGTG pLX_317 31% 99.2% 99.2% V5 (many diffs) n/a
Download CSV