Transcript: Mouse XM_011241057.1

PREDICTED: Mus musculus carboxypeptidase A2, pancreatic (Cpa2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpa2 (232680)
Length:
1144
CDS:
149..1093

Additional Resources:

NCBI RefSeq record:
XM_011241057.1
NBCI Gene record:
Cpa2 (232680)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086853 GCGTGGCACTAACTTCAACTT pLKO.1 172 CDS 100% 4.950 6.930 N Cpa2 n/a
2 TRCN0000086856 GCCAAGCCAGATGACTTTAAT pLKO.1 794 CDS 100% 15.000 10.500 N Cpa2 n/a
3 TRCN0000086855 GCAAAGTGAATATCGGTTCAT pLKO.1 267 CDS 100% 4.950 3.465 N Cpa2 n/a
4 TRCN0000086854 GCAAATAAGATTGCGTCTGAT pLKO.1 410 CDS 100% 4.950 3.465 N Cpa2 n/a
5 TRCN0000086857 TGGTCTAGTGAGCAAAGTGAA pLKO.1 256 CDS 100% 4.950 3.465 N Cpa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489062 TTACTTTCTCGCGTAATCCAAACG pLX_317 28.9% 65.6% 67.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_10424 pDONR223 100% 65.5% 67.8% None (many diffs) n/a
3 ccsbBroad304_10424 pLX_304 0% 65.5% 67.8% V5 (many diffs) n/a
4 TRCN0000491406 AAAGCCTTCCTATATTCCAACGTG pLX_317 31% 65.5% 67.8% V5 (many diffs) n/a
Download CSV