Construct: ORF TRCN0000489081
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020174.1_s317c1
- DNA Barcode:
- TAACAAAACCACTATGATTTGCAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- LIMK2 (3985)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489081
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3985 | LIMK2 | LIM domain kinase 2 | NM_001031801.2 | 100% | 100% | |
| 2 | human | 3985 | LIMK2 | LIM domain kinase 2 | NM_016733.3 | 87.6% | 78.3% | (many diffs) |
| 3 | human | 3985 | LIMK2 | LIM domain kinase 2 | NM_005569.4 | 83.9% | 74.3% | (many diffs) |
| 4 | human | 26472 | PPP1R14B | protein phosphatase 1 regul... | NM_138689.3 | 18.9% | 15.5% | (many diffs) |
| 5 | mouse | 16886 | Limk2 | LIM motif-containing protei... | NM_173053.1 | 78.3% | 74.6% | (many diffs) |
| 6 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514550.3 | 77.6% | 74% | (many diffs) |
| 7 | mouse | 16886 | Limk2 | LIM motif-containing protei... | NM_010718.4 | 75.4% | 71.3% | (many diffs) |
| 8 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514548.2 | 74.8% | 70.8% | (many diffs) |
| 9 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_011243666.2 | 70.1% | 66.8% | (many diffs) |
| 10 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514547.1 | 69.6% | 66.2% | (many diffs) |
| 11 | mouse | 16886 | Limk2 | LIM motif-containing protei... | NM_001034030.2 | 56.8% | 53.1% | (many diffs) |
| 12 | mouse | 16886 | Limk2 | LIM motif-containing protei... | XM_006514552.3 | 56.3% | 52.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2130
- ORF length:
- 2058
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggggagt tacttgtcag tcccggctta cttcacctcc agagacctgt 121 ttcggtgttc agaatgccag gattccctca ccaactggta ctatgagaag gatgggaagc 181 tctactgccc caaggactac tgggggaagt ttggggagtt ctgtcatggg tgctccctgc 241 tgatgacagg gccttttatg gtggctgggg agttcaagta ccacccagag tgctttgcct 301 gtatgagctg caaggtgatc attgaggatg gggatgcata tgcactggtg cagcatgcca 361 ccctctactg tgggaagtgc cacaatgagg tggtgctggc acccatgttt gagagactct 421 ccacagagtc tgttcaggag cagctgccct actctgtcac gctcatctcc atgccggcca 481 ccactgaagg caggcggggc ttctccgtgt ccgtggagag tgcctgctcc aactacgcca 541 ccactgtgca agtgaaagag gtcaaccgga tgcacatcag tcccaacaat cgaaacgcca 601 tccaccctgg ggaccgcatc ctggagatca atgggacccc cgtccgcaca cttcgagtgg 661 aggaggtgga ggatgcaatt agccagacga gccagacact tcagctgttg attgaacatg 721 accccgtctc ccaacgcctg gaccagctgc ggctggaggc ccggctcgct cctcacatgc 781 agaatgccgg acacccccac gccctcagca ccctggacac caaggagaat ctggagggga 841 cactgaggag acgttcccta aggcgcagta acagtatctc caagtcccct ggccccagct 901 ccccaaagga gcccctgctg ttcagccgtg acatcagccg ctcagaatcc cttcgttgtt 961 ccagcagcta ttcacagcag atcttccggc cctgtgacct aatccatggg gaggtcctgg 1021 ggaagggctt ctttgggcag gctatcaagg tgacacacaa agccacgggc aaagtgatgg 1081 tcatgaaaga gttaattcga tgtgatgagg agacccagaa aacttttctg actgaggtga 1141 aagtgatgcg cagcctggac caccccaatg tgctcaagtt cattggtgtg ctgtacaagg 1201 ataagaagct gaacctcctg acagagtaca ttgagggggg cacactgaag gactttctgc 1261 gcagtatgga tccgttcccc tggcagcaga aggtcaggtt tgccaaagga atcgcctccg 1321 gaatggccta tttgcactct atgtgcatca tccaccggga tctgaactcg cacaactgcc 1381 tcatcaagtt ggacaagact gtggtggtgg cagactttgg gctgtcacgg ctcatagtgg 1441 aagagaggaa aagggccccc atggagaagg ccaccaccaa gaaacgcacc ttgcgcaaga 1501 acgaccgcaa gaagcgctac acggtggtgg gaaaccccta ctggatggcc cctgagatgc 1561 tgaacggaaa gagctatgat gagacggtgg atatcttctc ctttgggatc gttctctgtg 1621 agatcattgg gcaggtgtat gcagatcctg actgccttcc ccgaacactg gactttggcc 1681 tcaacgtgaa gcttttctgg gagaagtttg ttcccacaga ttgtcccccg gccttcttcc 1741 cgctggccgc catctgctgc agactggagc ctgagagcag agcccccccc GGGGCCGCAG 1801 GAGAGGGCCC GGGCTGCGCG GATGATGAGG GCCCAGTGAG GCGCCAAGGG AAGGTCACCA 1861 TCAAGTATGA CCCCAAGGAG CTACGGAAGC ACCTCAACCT AGAGGAGTGG ATCCTGGAGC 1921 AGCTCACGCG CCTCTACGAC TGCCAGGAAG AGGAGATCTC AGAACTAGAG ATTGACGTGG 1981 ATGAGCTCCT GGACATGGAG AGTGACGATG CCTGGGCTTC CAGGGTCAAG GAGCTGCTGG 2041 TTGACTGTTA CAAACCCACA GAGGCCTTCA TCTCTGGCCT GCTGGACAAG ATCCGGGCCA 2101 TGCAGAAGCT GAGCACACCC CAGAAGAAGT GAGACCCAGC TTTCTTGTAC AAAGTGGTTG 2161 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 2221 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATA 2281 ACAAAACCAC TATGATTTGC ATACGCGTTA AGTCgacaat caacctctgg attacaaaat 2341 ttgtgaaaga tt